Incidental Mutation 'R6208:Col10a1'
ID503272
Institutional Source Beutler Lab
Gene Symbol Col10a1
Ensembl Gene ENSMUSG00000039462
Gene Namecollagen, type X, alpha 1
SynonymsCol10a-1, Col10
MMRRC Submission 044342-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R6208 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location34389981-34397085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34394586 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 185 (N185D)
Ref Sequence ENSEMBL: ENSMUSP00000101150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047885] [ENSMUST00000099973] [ENSMUST00000105511] [ENSMUST00000105512] [ENSMUST00000213269]
Predicted Effect probably benign
Transcript: ENSMUST00000047885
SMART Domains Protein: ENSMUSP00000047126
Gene: ENSMUSG00000039480

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 382 2.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099973
SMART Domains Protein: ENSMUSP00000097553
Gene: ENSMUSG00000039480

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 189 8.8e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105511
AA Change: N185D

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101150
Gene: ENSMUSG00000039462
AA Change: N185D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 60 101 N/A INTRINSIC
Pfam:Collagen 103 155 1.4e-9 PFAM
Pfam:Collagen 153 218 1.4e-8 PFAM
Pfam:Collagen 193 250 2.6e-9 PFAM
Pfam:Collagen 206 264 3.8e-8 PFAM
low complexity region 282 323 N/A INTRINSIC
internal_repeat_2 329 361 2.25e-6 PROSPERO
internal_repeat_1 331 365 5.9e-14 PROSPERO
low complexity region 368 383 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
Pfam:Collagen 413 483 9.3e-10 PFAM
low complexity region 487 517 N/A INTRINSIC
C1Q 545 680 2.85e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105512
SMART Domains Protein: ENSMUSP00000101151
Gene: ENSMUSG00000039480

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 372 8.7e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130290
Predicted Effect probably benign
Transcript: ENSMUST00000213269
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type X collagen, a short chain collagen expressed by hypertrophic chondrocytes during endochondral ossification. Unlike type VIII collagen, the other short chain collagen, type X collagen is a homotrimer. Mutations in this gene are associated with Schmid type metaphyseal chondrodysplasia (SMCD) and Japanese type spondylometaphyseal dysplasia (SMD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations may exhibit abnormal trabecular bone, thinner growth plate resting zone and articular cartilage, and altered bone content. Mice homozygous for another knock-out allele exhibit altered B and T cell populations and TH1/TH2responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A T 3: 32,711,894 I18F probably benign Het
Apol11a C T 15: 77,517,041 R243C probably damaging Het
Asap3 A G 4: 136,241,197 M687V probably benign Het
Axdnd1 C T 1: 156,392,856 probably benign Het
Baz2b A G 2: 59,924,806 F1026S probably damaging Het
Bsg T C 10: 79,708,838 L70P probably damaging Het
Col6a2 T A 10: 76,615,057 N50I possibly damaging Het
Cux2 G A 5: 121,860,822 P1352S possibly damaging Het
Defa25 A G 8: 21,085,181 probably null Het
Emc1 G T 4: 139,354,271 R70L probably damaging Het
Fat1 T C 8: 45,027,613 F3028S probably damaging Het
Fhit T C 14: 9,573,435 E205G probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm20830 T G Y: 6,916,792 E109A probably benign Homo
Grm1 A T 10: 10,719,946 F646Y probably damaging Het
Hp1bp3 A G 4: 138,217,170 probably benign Het
Lce1d G A 3: 92,686,005 P34S unknown Het
Lpar1 G A 4: 58,504,630 Q13* probably null Het
Lrrc61 C T 6: 48,568,905 R221* probably null Het
Map2 A G 1: 66,431,590 N328D probably damaging Het
Mndal T A 1: 173,857,422 D527V possibly damaging Het
Mycbp2 T G 14: 103,295,228 N430T probably benign Het
Myo1e A G 9: 70,376,605 Y861C probably damaging Het
Nav2 A G 7: 49,564,103 T1622A probably damaging Het
Nom1 A T 5: 29,449,619 H773L possibly damaging Het
Npc2 G T 12: 84,757,145 P144Q probably damaging Het
Npnt A G 3: 132,950,013 probably benign Het
Nxpe4 A T 9: 48,393,378 Y255F probably benign Het
Obscn G A 11: 59,067,648 A3769V possibly damaging Het
Optc T C 1: 133,904,999 D121G probably damaging Het
Pard6a T C 8: 105,702,234 F26L probably damaging Het
Pcdhga4 T A 18: 37,686,709 I437N probably damaging Het
Phf12 G T 11: 78,023,591 V71F probably damaging Het
Phf21b T A 15: 84,795,116 S282C probably damaging Het
Pou5f1 T C 17: 35,510,460 F323S possibly damaging Het
Psmd5 A T 2: 34,867,011 I67N probably damaging Het
Pyroxd1 A G 6: 142,357,456 K273R probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpusd1 A T 17: 25,730,378 H174L probably damaging Het
Ryr2 T C 13: 11,895,220 K94R probably benign Het
Scn2b A G 9: 45,118,030 R3G probably benign Het
Sf3b2 A T 19: 5,275,098 M782K possibly damaging Het
Skint7 A G 4: 111,984,876 probably null Het
Slc43a1 A G 2: 84,856,840 I319V possibly damaging Het
Snupn T A 9: 56,982,963 M356K probably damaging Het
Spata31d1a C A 13: 59,700,564 R1250M probably damaging Het
Sprr2h T C 3: 92,386,909 V21A unknown Het
Srpr A G 9: 35,215,995 T614A possibly damaging Het
Stk36 A T 1: 74,611,432 Q327L probably benign Het
Syne3 A G 12: 104,943,363 I738T probably benign Het
Tcea3 A T 4: 136,248,049 M1L probably damaging Het
Tead2 G T 7: 45,218,102 R85L probably damaging Het
Thap7 T C 16: 17,528,436 N228D possibly damaging Het
Trip11 T A 12: 101,898,895 E173V probably damaging Het
Ttc38 T A 15: 85,841,497 M187K possibly damaging Het
Vmn1r193 T A 13: 22,218,968 T285S possibly damaging Het
Vmn2r106 T C 17: 20,268,329 T603A probably damaging Het
Vps39 A T 2: 120,333,416 M355K probably damaging Het
Wnt5b G T 6: 119,446,512 L51I probably damaging Het
Xxylt1 A G 16: 31,007,808 Y230H probably benign Het
Other mutations in Col10a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03005:Col10a1 APN 10 34395738 missense probably damaging 1.00
IGL03028:Col10a1 APN 10 34395016 missense probably benign 0.19
R0580:Col10a1 UTSW 10 34394952 missense probably benign 0.31
R0691:Col10a1 UTSW 10 34395696 missense possibly damaging 0.94
R1187:Col10a1 UTSW 10 34394838 missense probably benign 0.13
R1597:Col10a1 UTSW 10 34395078 missense probably damaging 0.99
R1724:Col10a1 UTSW 10 34395718 missense probably damaging 1.00
R1826:Col10a1 UTSW 10 34394649 missense probably damaging 1.00
R1834:Col10a1 UTSW 10 34395015 missense probably damaging 1.00
R2156:Col10a1 UTSW 10 34395700 missense probably benign 0.30
R3687:Col10a1 UTSW 10 34395498 missense probably benign 0.12
R4208:Col10a1 UTSW 10 34395543 missense probably damaging 0.99
R4929:Col10a1 UTSW 10 34395124 missense probably benign 0.00
R5411:Col10a1 UTSW 10 34394557 missense probably damaging 1.00
R5433:Col10a1 UTSW 10 34390739 intron probably benign
R5481:Col10a1 UTSW 10 34395664 missense probably benign 0.09
R6036:Col10a1 UTSW 10 34395282 missense probably benign
R6036:Col10a1 UTSW 10 34395282 missense probably benign
R6223:Col10a1 UTSW 10 34395187 missense probably damaging 1.00
R7019:Col10a1 UTSW 10 34394951 missense probably damaging 0.96
R7642:Col10a1 UTSW 10 34395642 missense probably benign 0.00
R7784:Col10a1 UTSW 10 34394218 missense unknown
R8072:Col10a1 UTSW 10 34390667 missense unknown
R8711:Col10a1 UTSW 10 34394828 missense probably damaging 1.00
Z1176:Col10a1 UTSW 10 34395178 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATATCAGCCACGGGGAAGC -3'
(R):5'- GATGGTCCCATTTCTCCTGG -3'

Sequencing Primer
(F):5'- ACACAAAGGAGATATTGGCCC -3'
(R):5'- GGAAACCCCGGTCACCTTTG -3'
Posted On2018-02-27