Incidental Mutation 'R6208:Pou5f1'
ID503294
Institutional Source Beutler Lab
Gene Symbol Pou5f1
Ensembl Gene ENSMUSG00000024406
Gene NamePOU domain, class 5, transcription factor 1
SynonymsOtf-3, Oct-4, Oct3/4, Otf3, Otf4, Oct4, Oct-3/4, Otf3g, Oct-3, Otf3-rs7, Otf-4
MMRRC Submission 044342-MU
Accession Numbers

VEGA: OTTMUST00000096009; MGI: 101893

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6208 (G1)
Quality Score176.009
Status Validated
Chromosome17
Chromosomal Location35506018-35510772 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35510460 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 323 (F323S)
Ref Sequence ENSEMBL: ENSMUSP00000025271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025271] [ENSMUST00000159009] [ENSMUST00000160885] [ENSMUST00000161012] [ENSMUST00000162683] [ENSMUST00000172651] [ENSMUST00000173256] [ENSMUST00000173805] [ENSMUST00000173934] [ENSMUST00000174782]
PDB Structure SOLUTION STRUCTURE OF OCT3 POU-HOMEODOMAIN [SOLUTION NMR]
POU protein:DNA complex [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025271
AA Change: F323S

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025271
Gene: ENSMUSG00000024406
AA Change: F323S

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 39 49 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
POU 131 205 2.88e-47 SMART
HOX 223 285 4.75e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159009
SMART Domains Protein: ENSMUSP00000124449
Gene: ENSMUSG00000050410

DomainStartEndE-ValueType
low complexity region 11 16 N/A INTRINSIC
FHA 30 88 8.28e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160885
SMART Domains Protein: ENSMUSP00000125167
Gene: ENSMUSG00000050410

DomainStartEndE-ValueType
low complexity region 11 16 N/A INTRINSIC
FHA 30 88 8.28e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161012
SMART Domains Protein: ENSMUSP00000125310
Gene: ENSMUSG00000050410

DomainStartEndE-ValueType
low complexity region 11 16 N/A INTRINSIC
FHA 30 88 8.28e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162683
SMART Domains Protein: ENSMUSP00000125659
Gene: ENSMUSG00000050410

DomainStartEndE-ValueType
low complexity region 11 16 N/A INTRINSIC
FHA 30 88 8.28e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172651
SMART Domains Protein: ENSMUSP00000134654
Gene: ENSMUSG00000024406

DomainStartEndE-ValueType
POU 1 74 1.3e-45 SMART
Pfam:Homeobox 93 132 1.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173256
SMART Domains Protein: ENSMUSP00000134060
Gene: ENSMUSG00000024406

DomainStartEndE-ValueType
POU 1 74 1.3e-45 SMART
Pfam:Homeobox 93 132 1.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173805
SMART Domains Protein: ENSMUSP00000133633
Gene: ENSMUSG00000024406

DomainStartEndE-ValueType
POU 1 74 1.3e-45 SMART
Pfam:Homeobox 93 132 1.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173934
SMART Domains Protein: ENSMUSP00000134729
Gene: ENSMUSG00000024406

DomainStartEndE-ValueType
POU 1 74 1.3e-45 SMART
Pfam:Homeobox 93 132 1.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174782
SMART Domains Protein: ENSMUSP00000134493
Gene: ENSMUSG00000024406

DomainStartEndE-ValueType
POU 25 99 2.88e-47 SMART
Pfam:Homeobox 118 157 1.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175723
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the POU domain family of transcription factors. POU domain transcription factors bind to a specific octamer DNA motif and regulate cell type-specific differentiation pathways. The encoded protein plays a key role in embryonic development and stem cell pluripotency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygosity for a targeted null mutation results in peri-implantation lethality prior to the egg cylinder stage, associated with failure to develop a pluripotent inner cell mass. Conditional mutations show defects in reproduction. [provided by MGI curators]
Allele List at MGI

All alleles(86) : Targeted(7) Gene trapped(79)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a A T 3: 32,711,894 I18F probably benign Het
Apol11a C T 15: 77,517,041 R243C probably damaging Het
Asap3 A G 4: 136,241,197 M687V probably benign Het
Axdnd1 C T 1: 156,392,856 probably benign Het
Baz2b A G 2: 59,924,806 F1026S probably damaging Het
Bsg T C 10: 79,708,838 L70P probably damaging Het
Col10a1 A G 10: 34,394,586 N185D possibly damaging Het
Col6a2 T A 10: 76,615,057 N50I possibly damaging Het
Cux2 G A 5: 121,860,822 P1352S possibly damaging Het
Defa25 A G 8: 21,085,181 probably null Het
Emc1 G T 4: 139,354,271 R70L probably damaging Het
Fat1 T C 8: 45,027,613 F3028S probably damaging Het
Fhit T C 14: 9,573,435 E205G probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm20830 T G Y: 6,916,792 E109A probably benign Homo
Grm1 A T 10: 10,719,946 F646Y probably damaging Het
Hp1bp3 A G 4: 138,217,170 probably benign Het
Lce1d G A 3: 92,686,005 P34S unknown Het
Lpar1 G A 4: 58,504,630 Q13* probably null Het
Lrrc61 C T 6: 48,568,905 R221* probably null Het
Map2 A G 1: 66,431,590 N328D probably damaging Het
Mndal T A 1: 173,857,422 D527V possibly damaging Het
Mycbp2 T G 14: 103,295,228 N430T probably benign Het
Myo1e A G 9: 70,376,605 Y861C probably damaging Het
Nav2 A G 7: 49,564,103 T1622A probably damaging Het
Nom1 A T 5: 29,449,619 H773L possibly damaging Het
Npc2 G T 12: 84,757,145 P144Q probably damaging Het
Npnt A G 3: 132,950,013 probably benign Het
Nxpe4 A T 9: 48,393,378 Y255F probably benign Het
Obscn G A 11: 59,067,648 A3769V possibly damaging Het
Optc T C 1: 133,904,999 D121G probably damaging Het
Pard6a T C 8: 105,702,234 F26L probably damaging Het
Pcdhga4 T A 18: 37,686,709 I437N probably damaging Het
Phf12 G T 11: 78,023,591 V71F probably damaging Het
Phf21b T A 15: 84,795,116 S282C probably damaging Het
Psmd5 A T 2: 34,867,011 I67N probably damaging Het
Pyroxd1 A G 6: 142,357,456 K273R probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpusd1 A T 17: 25,730,378 H174L probably damaging Het
Ryr2 T C 13: 11,895,220 K94R probably benign Het
Scn2b A G 9: 45,118,030 R3G probably benign Het
Sf3b2 A T 19: 5,275,098 M782K possibly damaging Het
Skint7 A G 4: 111,984,876 probably null Het
Slc43a1 A G 2: 84,856,840 I319V possibly damaging Het
Snupn T A 9: 56,982,963 M356K probably damaging Het
Spata31d1a C A 13: 59,700,564 R1250M probably damaging Het
Sprr2h T C 3: 92,386,909 V21A unknown Het
Srpr A G 9: 35,215,995 T614A possibly damaging Het
Stk36 A T 1: 74,611,432 Q327L probably benign Het
Syne3 A G 12: 104,943,363 I738T probably benign Het
Tcea3 A T 4: 136,248,049 M1L probably damaging Het
Tead2 G T 7: 45,218,102 R85L probably damaging Het
Thap7 T C 16: 17,528,436 N228D possibly damaging Het
Trip11 T A 12: 101,898,895 E173V probably damaging Het
Ttc38 T A 15: 85,841,497 M187K possibly damaging Het
Vmn1r193 T A 13: 22,218,968 T285S possibly damaging Het
Vmn2r106 T C 17: 20,268,329 T603A probably damaging Het
Vps39 A T 2: 120,333,416 M355K probably damaging Het
Wnt5b G T 6: 119,446,512 L51I probably damaging Het
Xxylt1 A G 16: 31,007,808 Y230H probably benign Het
Other mutations in Pou5f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02744:Pou5f1 APN 17 35509414 missense probably damaging 1.00
IGL03062:Pou5f1 APN 17 35510039 missense possibly damaging 0.86
IGL03091:Pou5f1 APN 17 35510042 missense probably benign 0.32
R0553:Pou5f1 UTSW 17 35509477 missense possibly damaging 0.76
R2105:Pou5f1 UTSW 17 35510002 missense probably benign 0.01
R2231:Pou5f1 UTSW 17 35510062 missense probably benign
R4691:Pou5f1 UTSW 17 35506131 missense probably damaging 0.98
R4953:Pou5f1 UTSW 17 35510541 missense possibly damaging 0.54
R8171:Pou5f1 UTSW 17 35510036 missense probably benign 0.26
R8914:Pou5f1 UTSW 17 35510474 missense probably benign 0.00
R8957:Pou5f1 UTSW 17 35510469 missense possibly damaging 0.86
X0027:Pou5f1 UTSW 17 35506446 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCATCCTAGGTGGTTCGAGTATG -3'
(R):5'- AGGCTCCTGATCAACAGCATC -3'

Sequencing Primer
(F):5'- GGTTCTGTAACCGGCGC -3'
(R):5'- GCTTTTAATCCCTCCTCAGTAAAAG -3'
Posted On2018-02-27