Incidental Mutation 'R6209:Notch1'
ID503302
Institutional Source Beutler Lab
Gene Symbol Notch1
Ensembl Gene ENSMUSG00000026923
Gene Namenotch 1
SynonymsTan1, 9930111A19Rik, Mis6, Motch A, lin-12, N1
MMRRC Submission 044343-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6209 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location26457903-26516663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26472805 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 983 (N983S)
Ref Sequence ENSEMBL: ENSMUSP00000028288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028288] [ENSMUST00000132820]
PDB Structure The Crystal Structure of a Partial Mouse Notch-1 Ankyrin Domain: Repeats 4 Through 7 Preserve an Ankyrin Fold [X-RAY DIFFRACTION]
Mouse Notch 1 Ankyrin Repeat Intracellular Domain [X-RAY DIFFRACTION]
Structure of sugar modified epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of O-fucosylated epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1930-1949) peptide [X-RAY DIFFRACTION]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1997-2016) peptide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028288
AA Change: N983S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028288
Gene: ENSMUSG00000026923
AA Change: N983S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EGF 23 58 1.63e1 SMART
EGF 62 99 4.29e-5 SMART
EGF 105 139 6.25e-7 SMART
EGF_CA 140 176 1.02e-6 SMART
EGF_CA 178 216 4.21e-13 SMART
EGF 221 255 6.7e-7 SMART
EGF_CA 257 293 6.8e-8 SMART
EGF_CA 295 333 1.16e-10 SMART
EGF_CA 335 371 3.17e-8 SMART
EGF 375 410 5.32e-1 SMART
EGF_CA 412 450 4.59e-14 SMART
EGF_CA 452 488 1.02e-11 SMART
EGF_CA 490 526 4.81e-8 SMART
EGF_CA 528 564 3.19e-13 SMART
EGF_CA 566 601 1.91e-11 SMART
EGF_CA 603 639 1.78e-11 SMART
EGF_CA 641 676 9.62e-8 SMART
EGF_CA 678 714 2.38e-12 SMART
EGF_CA 716 751 5.23e-9 SMART
EGF_CA 753 789 6.25e-7 SMART
EGF_CA 791 827 1.1e-11 SMART
EGF 832 867 2.03e-6 SMART
EGF_CA 869 905 5.73e-15 SMART
EGF_CA 907 943 4.56e-9 SMART
EGF_CA 945 981 1.64e-10 SMART
EGF_CA 983 1019 5.83e-7 SMART
EGF_CA 1021 1057 1.05e-13 SMART
EGF 1062 1095 8.12e-6 SMART
EGF 1100 1143 5.66e-5 SMART
EGF_CA 1145 1181 1.1e-11 SMART
EGF_CA 1183 1219 3.87e-12 SMART
EGF_CA 1221 1265 2.89e-11 SMART
EGF_CA 1267 1305 1.2e-8 SMART
EGF 1310 1346 5.74e-6 SMART
EGF 1351 1384 4.1e-2 SMART
EGF 1390 1426 2.66e-1 SMART
NL 1442 1480 4.08e-16 SMART
NL 1483 1522 1.08e-15 SMART
NL 1523 1562 7.39e-14 SMART
NOD 1566 1622 1.81e-32 SMART
NODP 1660 1722 3.27e-30 SMART
low complexity region 1729 1746 N/A INTRINSIC
ANK 1870 1912 1.07e2 SMART
ANK 1917 1946 4.82e-3 SMART
ANK 1950 1980 6.71e-2 SMART
ANK 1984 2013 1.23e0 SMART
ANK 2017 2046 9.13e-4 SMART
ANK 2050 2079 2.97e-3 SMART
low complexity region 2205 2222 N/A INTRINSIC
low complexity region 2364 2395 N/A INTRINSIC
DUF3454 2453 2517 2.01e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129506
Predicted Effect probably benign
Transcript: ENSMUST00000132820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183922
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor plays a role in the development of numerous cell and tissue types. Mutations in this gene are associated with aortic valve disease, Adams-Oliver syndrome, T-cell acute lymphoblastic leukemia, chronic lymphocytic leukemia, and head and neck squamous cell carcinoma. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in lethality at some point in organogenesis. Lethal phenotype may be affected by genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 T A 1: 38,193,589 M990L probably benign Het
Agl A T 3: 116,785,196 Y429* probably null Het
Ahnak A T 19: 9,012,566 K3738M probably damaging Het
AI481877 A G 4: 59,043,869 *1482R probably null Het
Amn G T 12: 111,275,411 V304L probably damaging Het
Ap3s1 G A 18: 46,779,251 V113I probably benign Het
Arhgef28 A T 13: 97,929,409 probably null Het
Atad2 A G 15: 58,118,415 S18P probably damaging Het
C4b T A 17: 34,741,087 E305V possibly damaging Het
Caskin1 T C 17: 24,507,121 S1401P possibly damaging Het
Cblc A T 7: 19,785,305 V366D possibly damaging Het
Ccdc129 T A 6: 55,874,321 I62N probably damaging Het
Cdk17 A T 10: 93,208,231 T11S probably benign Het
Cenpc1 A G 5: 86,033,650 S619P probably benign Het
Clec4d T G 6: 123,270,529 probably null Het
Disp2 T C 2: 118,786,921 L132P probably damaging Het
Dync2h1 T C 9: 7,165,677 K528R probably benign Het
Fbxw26 A G 9: 109,717,965 I464T possibly damaging Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gabbr2 A G 4: 46,804,069 V262A probably damaging Het
Galnt17 T A 5: 131,081,596 M302L probably benign Het
Gm5096 C T 18: 87,757,217 A288V probably damaging Het
Gpn3 T C 5: 122,382,112 I243T probably benign Het
Gpr160 T C 3: 30,895,992 V71A possibly damaging Het
Gramd1b G T 9: 40,333,650 A154D probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
H60b C A 10: 22,287,144 T206N probably benign Het
Hydin A T 8: 110,593,802 I4493F probably benign Het
Il19 C T 1: 130,939,115 E43K possibly damaging Het
Ints2 A G 11: 86,225,058 Y782H probably damaging Het
Jph1 C A 1: 17,097,586 D7Y probably damaging Het
Lipo2 T C 19: 33,749,452 I62V probably damaging Het
Map7 G A 10: 20,276,280 probably null Het
Matk T G 10: 81,259,588 W81G probably damaging Het
Matn4 T C 2: 164,400,815 Y121C probably damaging Het
Mical2 G A 7: 112,324,086 probably null Het
Miga2 T G 2: 30,381,662 Y399D probably damaging Het
Mocos A T 18: 24,666,615 E302V probably benign Het
Mrpl11 C T 19: 4,964,715 A172V probably damaging Het
Mrpl48 A C 7: 100,559,794 Y108D probably damaging Het
Mtr A G 13: 12,190,392 S1061P probably benign Het
Myh11 T A 16: 14,208,291 K1309* probably null Het
Myom2 G A 8: 15,104,173 V704I possibly damaging Het
Nars2 A G 7: 97,057,521 H413R probably benign Het
Nckap1 A G 2: 80,525,602 L619P probably damaging Het
Nup210 A G 6: 91,025,355 V717A probably benign Het
P4ha3 G T 7: 100,317,085 G479V probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phf11a A G 14: 59,287,579 S59P probably damaging Het
Phyhip G A 14: 70,463,358 S95N probably benign Het
Ppat A G 5: 76,918,146 V375A probably benign Het
Prkdc A G 16: 15,790,592 E3086G probably damaging Het
Psg22 A G 7: 18,719,674 E98G probably damaging Het
Rabgap1 A T 2: 37,563,598 K1013* probably null Het
Retreg3 C T 11: 101,119,700 G27D probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sema6a A T 18: 47,298,302 probably null Het
Sept10 T C 10: 59,170,848 E349G probably damaging Het
Serpina1c A G 12: 103,897,170 V257A probably damaging Het
Sgpp2 T A 1: 78,390,482 M84K probably damaging Het
Skint11 A G 4: 114,244,710 S116G possibly damaging Het
Slc2a5 G A 4: 150,143,100 V459I probably benign Het
Smarca2 T G 19: 26,771,004 Y126* probably null Het
Stab2 T G 10: 86,923,003 N1024H possibly damaging Het
Svep1 A C 4: 58,128,869 F609L probably benign Het
Tbc1d2 G A 4: 46,614,068 T671I probably damaging Het
Thoc5 T C 11: 4,905,697 I82T probably damaging Het
Tmem173 A T 18: 35,736,102 I178N probably damaging Het
Tmem213 G T 6: 38,115,582 C83F probably damaging Het
Topaz1 G A 9: 122,750,505 D827N possibly damaging Het
Trappc10 C A 10: 78,214,812 G265V possibly damaging Het
Ttn A G 2: 76,709,464 S26066P probably damaging Het
Zfp292 G T 4: 34,809,442 Q1201K probably benign Het
Zfp354a T A 11: 51,060,988 probably null Het
Zfp418 T C 7: 7,182,097 V353A possibly damaging Het
Zfp444 G A 7: 6,189,949 probably benign Het
Zfp503 C A 14: 21,985,710 Q379H probably damaging Het
Zfp804a A G 2: 82,258,118 K764E probably damaging Het
Other mutations in Notch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Notch1 APN 2 26460046 missense probably damaging 0.98
IGL01343:Notch1 APN 2 26472905 missense probably benign 0.25
IGL02066:Notch1 APN 2 26460396 missense possibly damaging 0.71
IGL02158:Notch1 APN 2 26460339 missense probably damaging 1.00
IGL02541:Notch1 APN 2 26468503 missense probably benign 0.12
IGL03280:Notch1 APN 2 26477874 intron probably benign
IGL03338:Notch1 APN 2 26459959 missense probably benign
Antero UTSW 2 26476114 missense possibly damaging 0.96
march UTSW 2 26469899 missense probably damaging 0.98
PIT4494001:Notch1 UTSW 2 26466473 missense probably damaging 1.00
R0013:Notch1 UTSW 2 26473818 missense possibly damaging 0.64
R0025:Notch1 UTSW 2 26470931 missense probably damaging 1.00
R0129:Notch1 UTSW 2 26460458 missense probably benign 0.06
R0285:Notch1 UTSW 2 26460861 missense possibly damaging 0.88
R0531:Notch1 UTSW 2 26466572 missense probably benign 0.00
R0747:Notch1 UTSW 2 26472140 missense unknown
R1440:Notch1 UTSW 2 26480964 intron probably benign
R1502:Notch1 UTSW 2 26484323 missense possibly damaging 0.95
R1539:Notch1 UTSW 2 26472113 nonsense probably null
R1623:Notch1 UTSW 2 26478612 missense possibly damaging 0.88
R1844:Notch1 UTSW 2 26460434 missense probably benign 0.12
R1863:Notch1 UTSW 2 26469950 missense probably damaging 1.00
R1874:Notch1 UTSW 2 26481579 missense possibly damaging 0.89
R1926:Notch1 UTSW 2 26481657 missense probably damaging 1.00
R2156:Notch1 UTSW 2 26460861 missense possibly damaging 0.91
R2196:Notch1 UTSW 2 26463804 nonsense probably null
R2209:Notch1 UTSW 2 26460007 missense probably benign
R2382:Notch1 UTSW 2 26473781 missense probably benign 0.40
R2508:Notch1 UTSW 2 26465473 missense possibly damaging 0.80
R2873:Notch1 UTSW 2 26460235 missense possibly damaging 0.89
R2874:Notch1 UTSW 2 26460235 missense possibly damaging 0.89
R3798:Notch1 UTSW 2 26478618 missense probably benign 0.00
R4019:Notch1 UTSW 2 26481142 missense probably benign 0.03
R4305:Notch1 UTSW 2 26477924 missense probably damaging 1.00
R4334:Notch1 UTSW 2 26460036 missense probably benign 0.22
R4504:Notch1 UTSW 2 26472177 missense probably benign 0.16
R4624:Notch1 UTSW 2 26478081 missense possibly damaging 0.94
R4659:Notch1 UTSW 2 26470889 missense probably damaging 0.99
R4703:Notch1 UTSW 2 26471158 missense probably benign
R4869:Notch1 UTSW 2 26471179 missense probably benign 0.21
R4938:Notch1 UTSW 2 26474124 nonsense probably null
R4989:Notch1 UTSW 2 26481181 missense probably damaging 1.00
R5010:Notch1 UTSW 2 26476114 missense possibly damaging 0.96
R5283:Notch1 UTSW 2 26468626 missense probably damaging 1.00
R5303:Notch1 UTSW 2 26478619 missense probably benign 0.01
R5635:Notch1 UTSW 2 26476161 missense probably damaging 1.00
R5755:Notch1 UTSW 2 26473692 missense probably benign 0.12
R5926:Notch1 UTSW 2 26476104 missense probably benign 0.35
R5947:Notch1 UTSW 2 26462528 intron probably benign
R6053:Notch1 UTSW 2 26472912 missense probably benign 0.06
R6161:Notch1 UTSW 2 26468731 missense probably damaging 1.00
R6162:Notch1 UTSW 2 26462195 missense probably benign
R6174:Notch1 UTSW 2 26485442 missense possibly damaging 0.50
R6199:Notch1 UTSW 2 26469899 missense probably damaging 0.98
R6251:Notch1 UTSW 2 26474170 missense possibly damaging 0.64
R6493:Notch1 UTSW 2 26472098 missense unknown
R6723:Notch1 UTSW 2 26478106 missense probably damaging 1.00
R6736:Notch1 UTSW 2 26460286 missense probably benign 0.01
R7020:Notch1 UTSW 2 26481574 missense possibly damaging 0.95
R7058:Notch1 UTSW 2 26463818 missense probably benign 0.05
R7154:Notch1 UTSW 2 26459938 missense probably benign
R7291:Notch1 UTSW 2 26476375 missense probably benign 0.01
R7379:Notch1 UTSW 2 26479467 missense probably damaging 1.00
R7560:Notch1 UTSW 2 26460165 missense probably benign 0.43
R7610:Notch1 UTSW 2 26478179 missense probably benign 0.13
R7833:Notch1 UTSW 2 26459533 makesense probably null
R7988:Notch1 UTSW 2 26471001 missense probably benign 0.00
R8493:Notch1 UTSW 2 26472239 missense unknown
R8514:Notch1 UTSW 2 26472169 missense probably damaging 1.00
R8523:Notch1 UTSW 2 26464905 missense possibly damaging 0.82
R8677:Notch1 UTSW 2 26469924 missense probably damaging 1.00
R8696:Notch1 UTSW 2 26477992 critical splice acceptor site probably benign
R8833:Notch1 UTSW 2 26481603 missense probably damaging 1.00
X0018:Notch1 UTSW 2 26462227 nonsense probably null
X0066:Notch1 UTSW 2 26470335 missense possibly damaging 0.90
Z1088:Notch1 UTSW 2 26477115 missense probably damaging 0.99
Z1177:Notch1 UTSW 2 26460309 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- AGCATATAGACACGTGGTGG -3'
(R):5'- TGGCATCAACACAGCCTTC -3'

Sequencing Primer
(F):5'- GATAGGAGGCTAGTTCCCCAATTC -3'
(R):5'- GCCTTCTGCGACTGCCTG -3'
Posted On2018-02-27