Mutagenetix > Incidental Mutation

Incidental Mutation 'R6209:Notch1'

503302

Institutional Source

Beutler Lab

Gene Symbol

Notch1

Ensembl Gene

ENSMUSG00000026923

Gene Name

notch 1

Synonyms

Tan1, 9930111A19Rik, Mis6, Motch A, lin-12, N1

MMRRC Submission

044343-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6209 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

26457903-26516663 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 26472805 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 983 (N983S)

Ref Sequence

ENSEMBL: ENSMUSP00000028288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028288] [ENSMUST00000132820]

AlphaFold

Q01705

PDB Structure

The Crystal Structure of a Partial Mouse Notch-1 Ankyrin Domain: Repeats 4 Through 7 Preserve an Ankyrin Fold [X-RAY DIFFRACTION]
Mouse Notch 1 Ankyrin Repeat Intracellular Domain [X-RAY DIFFRACTION]
Structure of sugar modified epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of O-fucosylated epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1930-1949) peptide [X-RAY DIFFRACTION]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1997-2016) peptide [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028288
AA Change: N983S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000028288
Gene: ENSMUSG00000026923
AA Change: N983S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
EGF	23	58	1.63e1	SMART
EGF	62	99	4.29e-5	SMART
EGF	105	139	6.25e-7	SMART
EGF_CA	140	176	1.02e-6	SMART
EGF_CA	178	216	4.21e-13	SMART
EGF	221	255	6.7e-7	SMART
EGF_CA	257	293	6.8e-8	SMART
EGF_CA	295	333	1.16e-10	SMART
EGF_CA	335	371	3.17e-8	SMART
EGF	375	410	5.32e-1	SMART
EGF_CA	412	450	4.59e-14	SMART
EGF_CA	452	488	1.02e-11	SMART
EGF_CA	490	526	4.81e-8	SMART
EGF_CA	528	564	3.19e-13	SMART
EGF_CA	566	601	1.91e-11	SMART
EGF_CA	603	639	1.78e-11	SMART
EGF_CA	641	676	9.62e-8	SMART
EGF_CA	678	714	2.38e-12	SMART
EGF_CA	716	751	5.23e-9	SMART
EGF_CA	753	789	6.25e-7	SMART
EGF_CA	791	827	1.1e-11	SMART
EGF	832	867	2.03e-6	SMART
EGF_CA	869	905	5.73e-15	SMART
EGF_CA	907	943	4.56e-9	SMART
EGF_CA	945	981	1.64e-10	SMART
EGF_CA	983	1019	5.83e-7	SMART
EGF_CA	1021	1057	1.05e-13	SMART
EGF	1062	1095	8.12e-6	SMART
EGF	1100	1143	5.66e-5	SMART
EGF_CA	1145	1181	1.1e-11	SMART
EGF_CA	1183	1219	3.87e-12	SMART
EGF_CA	1221	1265	2.89e-11	SMART
EGF_CA	1267	1305	1.2e-8	SMART
EGF	1310	1346	5.74e-6	SMART
EGF	1351	1384	4.1e-2	SMART
EGF	1390	1426	2.66e-1	SMART
NL	1442	1480	4.08e-16	SMART
NL	1483	1522	1.08e-15	SMART
NL	1523	1562	7.39e-14	SMART
NOD	1566	1622	1.81e-32	SMART
NODP	1660	1722	3.27e-30	SMART
low complexity region	1729	1746	N/A	INTRINSIC
ANK	1870	1912	1.07e2	SMART
ANK	1917	1946	4.82e-3	SMART
ANK	1950	1980	6.71e-2	SMART
ANK	1984	2013	1.23e0	SMART
ANK	2017	2046	9.13e-4	SMART
ANK	2050	2079	2.97e-3	SMART
low complexity region	2205	2222	N/A	INTRINSIC
low complexity region	2364	2395	N/A	INTRINSIC
DUF3454	2453	2517	2.01e-30	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123873

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129506

Predicted Effect

probably benign
Transcript: ENSMUST00000132820

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183922

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor plays a role in the development of numerous cell and tissue types. Mutations in this gene are associated with aortic valve disease, Adams-Oliver syndrome, T-cell acute lymphoblastic leukemia, chronic lymphocytic leukemia, and head and neck squamous cell carcinoma. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in lethality at some point in organogenesis. Lethal phenotype may be affected by genetic background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aff3	T	A	1: 38,193,589	M990L	probably benign	Het
Agl	A	T	3: 116,785,196	Y429*	probably null	Het
Ahnak	A	T	19: 9,012,566	K3738M	probably damaging	Het
AI481877	A	G	4: 59,043,869	*1482R	probably null	Het
Amn	G	T	12: 111,275,411	V304L	probably damaging	Het
Ap3s1	G	A	18: 46,779,251	V113I	probably benign	Het
Arhgef28	A	T	13: 97,929,409		probably null	Het
Atad2	A	G	15: 58,118,415	S18P	probably damaging	Het
C4b	T	A	17: 34,741,087	E305V	possibly damaging	Het
Caskin1	T	C	17: 24,507,121	S1401P	possibly damaging	Het
Cblc	A	T	7: 19,785,305	V366D	possibly damaging	Het
Ccdc129	T	A	6: 55,874,321	I62N	probably damaging	Het
Cdk17	A	T	10: 93,208,231	T11S	probably benign	Het
Cenpc1	A	G	5: 86,033,650	S619P	probably benign	Het
Clec4d	T	G	6: 123,270,529		probably null	Het
Disp2	T	C	2: 118,786,921	L132P	probably damaging	Het
Dync2h1	T	C	9: 7,165,677	K528R	probably benign	Het
Fbxw26	A	G	9: 109,717,965	I464T	possibly damaging	Het
Gaa	C	A	11: 119,281,171	A700D	probably benign	Het
Gabbr2	A	G	4: 46,804,069	V262A	probably damaging	Het
Galnt17	T	A	5: 131,081,596	M302L	probably benign	Het
Gm5096	C	T	18: 87,757,217	A288V	probably damaging	Het
Gpn3	T	C	5: 122,382,112	I243T	probably benign	Het
Gpr160	T	C	3: 30,895,992	V71A	possibly damaging	Het
Gramd1b	G	T	9: 40,333,650	A154D	probably damaging	Het
Grid2ip	G	A	5: 143,380,429	S379N	probably damaging	Het
H60b	C	A	10: 22,287,144	T206N	probably benign	Het
Hydin	A	T	8: 110,593,802	I4493F	probably benign	Het
Il19	C	T	1: 130,939,115	E43K	possibly damaging	Het
Ints2	A	G	11: 86,225,058	Y782H	probably damaging	Het
Jph1	C	A	1: 17,097,586	D7Y	probably damaging	Het
Lipo2	T	C	19: 33,749,452	I62V	probably damaging	Het
Map7	G	A	10: 20,276,280		probably null	Het
Matk	T	G	10: 81,259,588	W81G	probably damaging	Het
Matn4	T	C	2: 164,400,815	Y121C	probably damaging	Het
Mical2	G	A	7: 112,324,086		probably null	Het
Miga2	T	G	2: 30,381,662	Y399D	probably damaging	Het
Mocos	A	T	18: 24,666,615	E302V	probably benign	Het
Mrpl11	C	T	19: 4,964,715	A172V	probably damaging	Het
Mrpl48	A	C	7: 100,559,794	Y108D	probably damaging	Het
Mtr	A	G	13: 12,190,392	S1061P	probably benign	Het
Myh11	T	A	16: 14,208,291	K1309*	probably null	Het
Myom2	G	A	8: 15,104,173	V704I	possibly damaging	Het
Nars2	A	G	7: 97,057,521	H413R	probably benign	Het
Nckap1	A	G	2: 80,525,602	L619P	probably damaging	Het
Nup210	A	G	6: 91,025,355	V717A	probably benign	Het
P4ha3	G	T	7: 100,317,085	G479V	probably benign	Het
Pcdhb18	G	A	18: 37,490,484	R289Q	probably benign	Het
Phf11a	A	G	14: 59,287,579	S59P	probably damaging	Het
Phyhip	G	A	14: 70,463,358	S95N	probably benign	Het
Ppat	A	G	5: 76,918,146	V375A	probably benign	Het
Prkdc	A	G	16: 15,790,592	E3086G	probably damaging	Het
Psg22	A	G	7: 18,719,674	E98G	probably damaging	Het
Rabgap1	A	T	2: 37,563,598	K1013*	probably null	Het
Retreg3	C	T	11: 101,119,700	G27D	probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rptn	C	G	3: 93,398,130	H923Q	possibly damaging	Het
Sema6a	A	T	18: 47,298,302		probably null	Het
Sept10	T	C	10: 59,170,848	E349G	probably damaging	Het
Serpina1c	A	G	12: 103,897,170	V257A	probably damaging	Het
Sgpp2	T	A	1: 78,390,482	M84K	probably damaging	Het
Skint11	A	G	4: 114,244,710	S116G	possibly damaging	Het
Slc2a5	G	A	4: 150,143,100	V459I	probably benign	Het
Smarca2	T	G	19: 26,771,004	Y126*	probably null	Het
Stab2	T	G	10: 86,923,003	N1024H	possibly damaging	Het
Svep1	A	C	4: 58,128,869	F609L	probably benign	Het
Tbc1d2	G	A	4: 46,614,068	T671I	probably damaging	Het
Thoc5	T	C	11: 4,905,697	I82T	probably damaging	Het
Tmem173	A	T	18: 35,736,102	I178N	probably damaging	Het
Tmem213	G	T	6: 38,115,582	C83F	probably damaging	Het
Topaz1	G	A	9: 122,750,505	D827N	possibly damaging	Het
Trappc10	C	A	10: 78,214,812	G265V	possibly damaging	Het
Ttn	A	G	2: 76,709,464	S26066P	probably damaging	Het
Zfp292	G	T	4: 34,809,442	Q1201K	probably benign	Het
Zfp354a	T	A	11: 51,060,988		probably null	Het
Zfp418	T	C	7: 7,182,097	V353A	possibly damaging	Het
Zfp444	G	A	7: 6,189,949		probably benign	Het
Zfp503	C	A	14: 21,985,710	Q379H	probably damaging	Het
Zfp804a	A	G	2: 82,258,118	K764E	probably damaging	Het

Other mutations in Notch1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Notch1	APN	2	26460046	missense	probably damaging	0.98
IGL01343:Notch1	APN	2	26472905	missense	probably benign	0.25
IGL02066:Notch1	APN	2	26460396	missense	possibly damaging	0.71
IGL02158:Notch1	APN	2	26460339	missense	probably damaging	1.00
IGL02541:Notch1	APN	2	26468503	missense	probably benign	0.12
IGL03280:Notch1	APN	2	26477874	intron	probably benign
IGL03338:Notch1	APN	2	26459959	missense	probably benign
Antero	UTSW	2	26476114	missense	possibly damaging	0.96
march	UTSW	2	26469899	missense	probably damaging	0.98
PIT4494001:Notch1	UTSW	2	26466473	missense	probably damaging	1.00
R0013:Notch1	UTSW	2	26473818	missense	possibly damaging	0.64
R0025:Notch1	UTSW	2	26470931	missense	probably damaging	1.00
R0129:Notch1	UTSW	2	26460458	missense	probably benign	0.06
R0285:Notch1	UTSW	2	26460861	missense	possibly damaging	0.88
R0531:Notch1	UTSW	2	26466572	missense	probably benign	0.00
R0747:Notch1	UTSW	2	26472140	missense	unknown
R1440:Notch1	UTSW	2	26480964	intron	probably benign
R1502:Notch1	UTSW	2	26484323	missense	possibly damaging	0.95
R1539:Notch1	UTSW	2	26472113	nonsense	probably null
R1623:Notch1	UTSW	2	26478612	missense	possibly damaging	0.88
R1844:Notch1	UTSW	2	26460434	missense	probably benign	0.12
R1863:Notch1	UTSW	2	26469950	missense	probably damaging	1.00
R1874:Notch1	UTSW	2	26481579	missense	possibly damaging	0.89
R1926:Notch1	UTSW	2	26481657	missense	probably damaging	1.00
R2156:Notch1	UTSW	2	26460861	missense	possibly damaging	0.91
R2196:Notch1	UTSW	2	26463804	nonsense	probably null
R2209:Notch1	UTSW	2	26460007	missense	probably benign
R2382:Notch1	UTSW	2	26473781	missense	probably benign	0.40
R2508:Notch1	UTSW	2	26465473	missense	possibly damaging	0.80
R2873:Notch1	UTSW	2	26460235	missense	possibly damaging	0.89
R2874:Notch1	UTSW	2	26460235	missense	possibly damaging	0.89
R3798:Notch1	UTSW	2	26478618	missense	probably benign	0.00
R4019:Notch1	UTSW	2	26481142	missense	probably benign	0.03
R4305:Notch1	UTSW	2	26477924	missense	probably damaging	1.00
R4334:Notch1	UTSW	2	26460036	missense	probably benign	0.22
R4504:Notch1	UTSW	2	26472177	missense	probably benign	0.16
R4624:Notch1	UTSW	2	26478081	missense	possibly damaging	0.94
R4659:Notch1	UTSW	2	26470889	missense	probably damaging	0.99
R4703:Notch1	UTSW	2	26471158	missense	probably benign
R4869:Notch1	UTSW	2	26471179	missense	probably benign	0.21
R4938:Notch1	UTSW	2	26474124	nonsense	probably null
R4989:Notch1	UTSW	2	26481181	missense	probably damaging	1.00
R5010:Notch1	UTSW	2	26476114	missense	possibly damaging	0.96
R5283:Notch1	UTSW	2	26468626	missense	probably damaging	1.00
R5303:Notch1	UTSW	2	26478619	missense	probably benign	0.01
R5635:Notch1	UTSW	2	26476161	missense	probably damaging	1.00
R5755:Notch1	UTSW	2	26473692	missense	probably benign	0.12
R5926:Notch1	UTSW	2	26476104	missense	probably benign	0.35
R5947:Notch1	UTSW	2	26462528	intron	probably benign
R6053:Notch1	UTSW	2	26472912	missense	probably benign	0.06
R6161:Notch1	UTSW	2	26468731	missense	probably damaging	1.00
R6162:Notch1	UTSW	2	26462195	missense	probably benign
R6174:Notch1	UTSW	2	26485442	missense	possibly damaging	0.50
R6199:Notch1	UTSW	2	26469899	missense	probably damaging	0.98
R6251:Notch1	UTSW	2	26474170	missense	possibly damaging	0.64
R6493:Notch1	UTSW	2	26472098	missense	unknown
R6723:Notch1	UTSW	2	26478106	missense	probably damaging	1.00
R6736:Notch1	UTSW	2	26460286	missense	probably benign	0.01
R7020:Notch1	UTSW	2	26481574	missense	possibly damaging	0.95
R7058:Notch1	UTSW	2	26463818	missense	probably benign	0.05
R7154:Notch1	UTSW	2	26459938	missense	probably benign
R7291:Notch1	UTSW	2	26476375	missense	probably benign	0.01
R7379:Notch1	UTSW	2	26479467	missense	probably damaging	1.00
R7560:Notch1	UTSW	2	26460165	missense	probably benign	0.43
R7610:Notch1	UTSW	2	26478179	missense	probably benign	0.13
R7833:Notch1	UTSW	2	26459533	makesense	probably null
R7988:Notch1	UTSW	2	26471001	missense	probably benign	0.00
R8493:Notch1	UTSW	2	26472239	missense	unknown
R8514:Notch1	UTSW	2	26472169	missense	probably damaging	1.00
R8523:Notch1	UTSW	2	26464905	missense	possibly damaging	0.82
R8677:Notch1	UTSW	2	26469924	missense	probably damaging	1.00
R8696:Notch1	UTSW	2	26477992	critical splice acceptor site	probably benign
R8833:Notch1	UTSW	2	26481603	missense	probably damaging	1.00
R8964:Notch1	UTSW	2	26481050	missense	possibly damaging	0.65
R9091:Notch1	UTSW	2	26479883	missense	probably damaging	0.99
R9144:Notch1	UTSW	2	26459575	missense	probably benign	0.00
R9145:Notch1	UTSW	2	26459575	missense	probably benign	0.00
R9151:Notch1	UTSW	2	26477927	missense	probably benign	0.01
R9270:Notch1	UTSW	2	26479883	missense	probably damaging	0.99
R9463:Notch1	UTSW	2	26469833	missense	probably benign	0.20
R9546:Notch1	UTSW	2	26481115	missense	probably damaging	0.97
R9674:Notch1	UTSW	2	26471296	missense	probably damaging	0.98
X0018:Notch1	UTSW	2	26462227	nonsense	probably null
X0066:Notch1	UTSW	2	26470335	missense	possibly damaging	0.90
Z1088:Notch1	UTSW	2	26477115	missense	probably damaging	0.99
Z1177:Notch1	UTSW	2	26460309	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- AGCATATAGACACGTGGTGG -3'
(R):5'- TGGCATCAACACAGCCTTC -3'

Sequencing Primer
(F):5'- GATAGGAGGCTAGTTCCCCAATTC -3'
(R):5'- GCCTTCTGCGACTGCCTG -3'

Posted On

2018-02-27