Incidental Mutation 'R6209:Mrpl48'
ID503335
Institutional Source Beutler Lab
Gene Symbol Mrpl48
Ensembl Gene ENSMUSG00000030706
Gene Namemitochondrial ribosomal protein L48
SynonymsCGI-118, 1810030E20Rik, D4Ertd786e
MMRRC Submission 044343-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.880) question?
Stock #R6209 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location100545751-100608301 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 100559794 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 108 (Y108D)
Ref Sequence ENSEMBL: ENSMUSP00000116090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107053] [ENSMUST00000132888] [ENSMUST00000137777] [ENSMUST00000138448] [ENSMUST00000146003] [ENSMUST00000150042] [ENSMUST00000152876]
Predicted Effect probably benign
Transcript: ENSMUST00000107053
Predicted Effect probably damaging
Transcript: ENSMUST00000132888
AA Change: Y10D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000137777
AA Change: Y10D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000138448
AA Change: Y10D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000146003
AA Change: Y10D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000150042
AA Change: Y108D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116090
Gene: ENSMUSG00000030706
AA Change: Y108D

DomainStartEndE-ValueType
low complexity region 62 74 N/A INTRINSIC
Pfam:Ribosomal_S10 91 186 2.6e-16 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000152876
AA Change: Y113D
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. A pseudogene corresponding to this gene is found on chromosome 6p. Several transcript variants, some protein-coding and some non-protein coding, have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 T A 1: 38,193,589 M990L probably benign Het
Agl A T 3: 116,785,196 Y429* probably null Het
Ahnak A T 19: 9,012,566 K3738M probably damaging Het
AI481877 A G 4: 59,043,869 *1482R probably null Het
Amn G T 12: 111,275,411 V304L probably damaging Het
Ap3s1 G A 18: 46,779,251 V113I probably benign Het
Arhgef28 A T 13: 97,929,409 probably null Het
Atad2 A G 15: 58,118,415 S18P probably damaging Het
C4b T A 17: 34,741,087 E305V possibly damaging Het
Caskin1 T C 17: 24,507,121 S1401P possibly damaging Het
Cblc A T 7: 19,785,305 V366D possibly damaging Het
Ccdc129 T A 6: 55,874,321 I62N probably damaging Het
Cdk17 A T 10: 93,208,231 T11S probably benign Het
Cenpc1 A G 5: 86,033,650 S619P probably benign Het
Clec4d T G 6: 123,270,529 probably null Het
Disp2 T C 2: 118,786,921 L132P probably damaging Het
Dync2h1 T C 9: 7,165,677 K528R probably benign Het
Fbxw26 A G 9: 109,717,965 I464T possibly damaging Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gabbr2 A G 4: 46,804,069 V262A probably damaging Het
Galnt17 T A 5: 131,081,596 M302L probably benign Het
Gm5096 C T 18: 87,757,217 A288V probably damaging Het
Gpn3 T C 5: 122,382,112 I243T probably benign Het
Gpr160 T C 3: 30,895,992 V71A possibly damaging Het
Gramd1b G T 9: 40,333,650 A154D probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
H60b C A 10: 22,287,144 T206N probably benign Het
Hydin A T 8: 110,593,802 I4493F probably benign Het
Il19 C T 1: 130,939,115 E43K possibly damaging Het
Ints2 A G 11: 86,225,058 Y782H probably damaging Het
Jph1 C A 1: 17,097,586 D7Y probably damaging Het
Lipo2 T C 19: 33,749,452 I62V probably damaging Het
Map7 G A 10: 20,276,280 probably null Het
Matk T G 10: 81,259,588 W81G probably damaging Het
Matn4 T C 2: 164,400,815 Y121C probably damaging Het
Mical2 G A 7: 112,324,086 probably null Het
Miga2 T G 2: 30,381,662 Y399D probably damaging Het
Mocos A T 18: 24,666,615 E302V probably benign Het
Mrpl11 C T 19: 4,964,715 A172V probably damaging Het
Mtr A G 13: 12,190,392 S1061P probably benign Het
Myh11 T A 16: 14,208,291 K1309* probably null Het
Myom2 G A 8: 15,104,173 V704I possibly damaging Het
Nars2 A G 7: 97,057,521 H413R probably benign Het
Nckap1 A G 2: 80,525,602 L619P probably damaging Het
Notch1 T C 2: 26,472,805 N983S probably damaging Het
Nup210 A G 6: 91,025,355 V717A probably benign Het
P4ha3 G T 7: 100,317,085 G479V probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phf11a A G 14: 59,287,579 S59P probably damaging Het
Phyhip G A 14: 70,463,358 S95N probably benign Het
Ppat A G 5: 76,918,146 V375A probably benign Het
Prkdc A G 16: 15,790,592 E3086G probably damaging Het
Psg22 A G 7: 18,719,674 E98G probably damaging Het
Rabgap1 A T 2: 37,563,598 K1013* probably null Het
Retreg3 C T 11: 101,119,700 G27D probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sema6a A T 18: 47,298,302 probably null Het
Sept10 T C 10: 59,170,848 E349G probably damaging Het
Serpina1c A G 12: 103,897,170 V257A probably damaging Het
Sgpp2 T A 1: 78,390,482 M84K probably damaging Het
Skint11 A G 4: 114,244,710 S116G possibly damaging Het
Slc2a5 G A 4: 150,143,100 V459I probably benign Het
Smarca2 T G 19: 26,771,004 Y126* probably null Het
Stab2 T G 10: 86,923,003 N1024H possibly damaging Het
Svep1 A C 4: 58,128,869 F609L probably benign Het
Tbc1d2 G A 4: 46,614,068 T671I probably damaging Het
Thoc5 T C 11: 4,905,697 I82T probably damaging Het
Tmem173 A T 18: 35,736,102 I178N probably damaging Het
Tmem213 G T 6: 38,115,582 C83F probably damaging Het
Topaz1 G A 9: 122,750,505 D827N possibly damaging Het
Trappc10 C A 10: 78,214,812 G265V possibly damaging Het
Ttn A G 2: 76,709,464 S26066P probably damaging Het
Zfp292 G T 4: 34,809,442 Q1201K probably benign Het
Zfp354a T A 11: 51,060,988 probably null Het
Zfp418 T C 7: 7,182,097 V353A possibly damaging Het
Zfp444 G A 7: 6,189,949 probably benign Het
Zfp503 C A 14: 21,985,710 Q379H probably damaging Het
Zfp804a A G 2: 82,258,118 K764E probably damaging Het
Other mutations in Mrpl48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Mrpl48 APN 7 100550532 splice site probably benign
IGL01838:Mrpl48 APN 7 100552653 missense probably damaging 1.00
IGL02395:Mrpl48 APN 7 100546344 utr 3 prime probably benign
IGL02878:Mrpl48 APN 7 100574513 missense possibly damaging 0.92
R0195:Mrpl48 UTSW 7 100546353 utr 3 prime probably benign
R1498:Mrpl48 UTSW 7 100546488 utr 3 prime probably benign
R1619:Mrpl48 UTSW 7 100546275 utr 3 prime probably benign
R2058:Mrpl48 UTSW 7 100549333 missense probably damaging 1.00
R2059:Mrpl48 UTSW 7 100549333 missense probably damaging 1.00
R2279:Mrpl48 UTSW 7 100565264 missense probably damaging 1.00
R3952:Mrpl48 UTSW 7 100559923 splice site probably benign
R4682:Mrpl48 UTSW 7 100549369 missense probably damaging 0.96
R4887:Mrpl48 UTSW 7 100546409 utr 3 prime probably benign
R5225:Mrpl48 UTSW 7 100549328 missense probably damaging 0.97
R5278:Mrpl48 UTSW 7 100552583 missense probably damaging 1.00
R5405:Mrpl48 UTSW 7 100559793 missense probably damaging 1.00
R6809:Mrpl48 UTSW 7 100546367 utr 3 prime probably benign
R7666:Mrpl48 UTSW 7 100565201 missense probably benign
R8518:Mrpl48 UTSW 7 100583062 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCAACTTAAAACCTGGGCTAGAT -3'
(R):5'- CATCTCAAAAGGATAAACTGAAGGAA -3'

Sequencing Primer
(F):5'- ACCTGGGCTAGATAACTTATCAGTGG -3'
(R):5'- AGACCTGGTTAGCCTTGAAC -3'
Posted On2018-02-27