Incidental Mutation 'R6209:Ints2'
ID 503352
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Name integrator complex subunit 2
Synonyms 2810417D08Rik
MMRRC Submission 044343-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6209 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 86101507-86148401 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86115884 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 782 (Y782H)
Ref Sequence ENSEMBL: ENSMUSP00000103674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]
AlphaFold Q80UK8
Predicted Effect probably damaging
Transcript: ENSMUST00000018212
AA Change: Y782H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: Y782H

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108039
AA Change: Y782H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: Y782H

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146421
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 T A 1: 38,232,670 (GRCm39) M990L probably benign Het
Agl A T 3: 116,578,845 (GRCm39) Y429* probably null Het
Ahnak A T 19: 8,989,930 (GRCm39) K3738M probably damaging Het
Amn G T 12: 111,241,845 (GRCm39) V304L probably damaging Het
Ap3s1 G A 18: 46,912,318 (GRCm39) V113I probably benign Het
Arhgef28 A T 13: 98,065,917 (GRCm39) probably null Het
Atad2 A G 15: 57,981,811 (GRCm39) S18P probably damaging Het
Bhmt1b C T 18: 87,775,341 (GRCm39) A288V probably damaging Het
C4b T A 17: 34,960,061 (GRCm39) E305V possibly damaging Het
Caskin1 T C 17: 24,726,095 (GRCm39) S1401P possibly damaging Het
Cblc A T 7: 19,519,230 (GRCm39) V366D possibly damaging Het
Cdk17 A T 10: 93,044,093 (GRCm39) T11S probably benign Het
Cenpc1 A G 5: 86,181,509 (GRCm39) S619P probably benign Het
Clec4d T G 6: 123,247,488 (GRCm39) probably null Het
Disp2 T C 2: 118,617,402 (GRCm39) L132P probably damaging Het
Dync2h1 T C 9: 7,165,677 (GRCm39) K528R probably benign Het
Fbxw26 A G 9: 109,547,033 (GRCm39) I464T possibly damaging Het
Gaa C A 11: 119,171,997 (GRCm39) A700D probably benign Het
Gabbr2 A G 4: 46,804,069 (GRCm39) V262A probably damaging Het
Galnt17 T A 5: 131,110,434 (GRCm39) M302L probably benign Het
Gpn3 T C 5: 122,520,175 (GRCm39) I243T probably benign Het
Gpr160 T C 3: 30,950,141 (GRCm39) V71A possibly damaging Het
Gramd1b G T 9: 40,244,946 (GRCm39) A154D probably damaging Het
Grid2ip G A 5: 143,366,184 (GRCm39) S379N probably damaging Het
H60b C A 10: 22,163,043 (GRCm39) T206N probably benign Het
Hydin A T 8: 111,320,434 (GRCm39) I4493F probably benign Het
Il19 C T 1: 130,866,852 (GRCm39) E43K possibly damaging Het
Itprid1 T A 6: 55,851,306 (GRCm39) I62N probably damaging Het
Jph1 C A 1: 17,167,810 (GRCm39) D7Y probably damaging Het
Lipo2 T C 19: 33,726,852 (GRCm39) I62V probably damaging Het
Map7 G A 10: 20,152,026 (GRCm39) probably null Het
Matk T G 10: 81,095,422 (GRCm39) W81G probably damaging Het
Matn4 T C 2: 164,242,735 (GRCm39) Y121C probably damaging Het
Mical2 G A 7: 111,923,293 (GRCm39) probably null Het
Miga2 T G 2: 30,271,674 (GRCm39) Y399D probably damaging Het
Mocos A T 18: 24,799,672 (GRCm39) E302V probably benign Het
Mrpl11 C T 19: 5,014,743 (GRCm39) A172V probably damaging Het
Mrpl48 A C 7: 100,209,001 (GRCm39) Y108D probably damaging Het
Mtr A G 13: 12,205,278 (GRCm39) S1061P probably benign Het
Myh11 T A 16: 14,026,155 (GRCm39) K1309* probably null Het
Myom2 G A 8: 15,154,173 (GRCm39) V704I possibly damaging Het
Nars2 A G 7: 96,706,728 (GRCm39) H413R probably benign Het
Nckap1 A G 2: 80,355,946 (GRCm39) L619P probably damaging Het
Notch1 T C 2: 26,362,817 (GRCm39) N983S probably damaging Het
Nup210 A G 6: 91,002,337 (GRCm39) V717A probably benign Het
P4ha3 G T 7: 99,966,292 (GRCm39) G479V probably benign Het
Pcdhb18 G A 18: 37,623,537 (GRCm39) R289Q probably benign Het
Phf11a A G 14: 59,525,028 (GRCm39) S59P probably damaging Het
Phyhip G A 14: 70,700,798 (GRCm39) S95N probably benign Het
Ppat A G 5: 77,065,993 (GRCm39) V375A probably benign Het
Prkdc A G 16: 15,608,456 (GRCm39) E3086G probably damaging Het
Psg22 A G 7: 18,453,599 (GRCm39) E98G probably damaging Het
Rabgap1 A T 2: 37,453,610 (GRCm39) K1013* probably null Het
Retreg3 C T 11: 101,010,526 (GRCm39) G27D probably benign Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rptn C G 3: 93,305,437 (GRCm39) H923Q possibly damaging Het
Sema6a A T 18: 47,431,369 (GRCm39) probably null Het
Septin10 T C 10: 59,006,670 (GRCm39) E349G probably damaging Het
Serpina1c A G 12: 103,863,429 (GRCm39) V257A probably damaging Het
Sgpp2 T A 1: 78,367,119 (GRCm39) M84K probably damaging Het
Shoc1 A G 4: 59,043,869 (GRCm39) *1482R probably null Het
Skint11 A G 4: 114,101,907 (GRCm39) S116G possibly damaging Het
Slc2a5 G A 4: 150,227,557 (GRCm39) V459I probably benign Het
Smarca2 T G 19: 26,748,404 (GRCm39) Y126* probably null Het
Stab2 T G 10: 86,758,867 (GRCm39) N1024H possibly damaging Het
Sting1 A T 18: 35,869,155 (GRCm39) I178N probably damaging Het
Svep1 A C 4: 58,128,869 (GRCm39) F609L probably benign Het
Tbc1d2 G A 4: 46,614,068 (GRCm39) T671I probably damaging Het
Thoc5 T C 11: 4,855,697 (GRCm39) I82T probably damaging Het
Tmem213 G T 6: 38,092,517 (GRCm39) C83F probably damaging Het
Topaz1 G A 9: 122,579,570 (GRCm39) D827N possibly damaging Het
Trappc10 C A 10: 78,050,646 (GRCm39) G265V possibly damaging Het
Ttn A G 2: 76,539,808 (GRCm39) S26066P probably damaging Het
Zfp292 G T 4: 34,809,442 (GRCm39) Q1201K probably benign Het
Zfp354a T A 11: 50,951,815 (GRCm39) probably null Het
Zfp418 T C 7: 7,185,096 (GRCm39) V353A possibly damaging Het
Zfp444 G A 7: 6,192,948 (GRCm39) probably benign Het
Zfp503 C A 14: 22,035,778 (GRCm39) Q379H probably damaging Het
Zfp804a A G 2: 82,088,462 (GRCm39) K764E probably damaging Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86,123,961 (GRCm39) missense probably damaging 1.00
IGL02490:Ints2 APN 11 86,124,009 (GRCm39) missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86,106,404 (GRCm39) missense probably damaging 1.00
IGL03396:Ints2 APN 11 86,103,888 (GRCm39) missense probably damaging 0.99
R0015:Ints2 UTSW 11 86,140,113 (GRCm39) missense probably damaging 1.00
R0015:Ints2 UTSW 11 86,140,113 (GRCm39) missense probably damaging 1.00
R0355:Ints2 UTSW 11 86,125,575 (GRCm39) missense probably benign 0.00
R0389:Ints2 UTSW 11 86,139,677 (GRCm39) missense probably damaging 1.00
R0631:Ints2 UTSW 11 86,124,022 (GRCm39) missense probably benign 0.02
R0944:Ints2 UTSW 11 86,135,289 (GRCm39) missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1269:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1270:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1396:Ints2 UTSW 11 86,140,074 (GRCm39) missense probably damaging 0.98
R1474:Ints2 UTSW 11 86,117,607 (GRCm39) missense probably damaging 0.97
R1503:Ints2 UTSW 11 86,117,607 (GRCm39) missense probably damaging 0.97
R1840:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1987:Ints2 UTSW 11 86,108,626 (GRCm39) missense probably benign 0.03
R1990:Ints2 UTSW 11 86,139,760 (GRCm39) missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86,139,760 (GRCm39) missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86,133,827 (GRCm39) missense probably benign 0.41
R4056:Ints2 UTSW 11 86,133,778 (GRCm39) missense probably damaging 1.00
R4057:Ints2 UTSW 11 86,133,778 (GRCm39) missense probably damaging 1.00
R4569:Ints2 UTSW 11 86,147,024 (GRCm39) missense probably damaging 1.00
R4585:Ints2 UTSW 11 86,140,101 (GRCm39) missense probably damaging 1.00
R4586:Ints2 UTSW 11 86,140,101 (GRCm39) missense probably damaging 1.00
R4806:Ints2 UTSW 11 86,147,035 (GRCm39) missense probably benign 0.10
R4929:Ints2 UTSW 11 86,103,479 (GRCm39) missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86,147,026 (GRCm39) missense probably damaging 1.00
R5064:Ints2 UTSW 11 86,140,100 (GRCm39) missense probably damaging 1.00
R5270:Ints2 UTSW 11 86,106,621 (GRCm39) missense probably damaging 1.00
R5621:Ints2 UTSW 11 86,133,773 (GRCm39) missense probably benign 0.32
R5875:Ints2 UTSW 11 86,129,138 (GRCm39) missense probably benign 0.04
R5908:Ints2 UTSW 11 86,106,371 (GRCm39) critical splice donor site probably null
R5914:Ints2 UTSW 11 86,113,000 (GRCm39) missense probably benign 0.03
R5941:Ints2 UTSW 11 86,141,798 (GRCm39) missense probably benign 0.01
R5975:Ints2 UTSW 11 86,117,574 (GRCm39) missense possibly damaging 0.72
R6003:Ints2 UTSW 11 86,129,294 (GRCm39) missense probably damaging 1.00
R6091:Ints2 UTSW 11 86,127,429 (GRCm39) missense probably damaging 0.96
R6567:Ints2 UTSW 11 86,117,487 (GRCm39) missense probably benign 0.42
R6764:Ints2 UTSW 11 86,103,605 (GRCm39) missense probably benign 0.00
R7033:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R7132:Ints2 UTSW 11 86,108,580 (GRCm39) missense probably benign 0.26
R7337:Ints2 UTSW 11 86,108,668 (GRCm39) missense probably benign 0.00
R7410:Ints2 UTSW 11 86,124,052 (GRCm39) missense probably benign 0.02
R7483:Ints2 UTSW 11 86,106,444 (GRCm39) missense probably damaging 1.00
R7503:Ints2 UTSW 11 86,122,881 (GRCm39) missense probably benign
R7804:Ints2 UTSW 11 86,103,489 (GRCm39) missense possibly damaging 0.92
R7845:Ints2 UTSW 11 86,129,089 (GRCm39) missense possibly damaging 0.93
R7875:Ints2 UTSW 11 86,103,888 (GRCm39) missense probably damaging 0.99
R7918:Ints2 UTSW 11 86,113,043 (GRCm39) missense probably damaging 1.00
R7922:Ints2 UTSW 11 86,135,453 (GRCm39) missense probably benign 0.29
R8058:Ints2 UTSW 11 86,146,179 (GRCm39) missense probably benign 0.05
R8134:Ints2 UTSW 11 86,103,486 (GRCm39) missense probably damaging 1.00
R8189:Ints2 UTSW 11 86,106,396 (GRCm39) missense probably damaging 1.00
R8295:Ints2 UTSW 11 86,115,914 (GRCm39) missense probably damaging 0.97
R8348:Ints2 UTSW 11 86,146,249 (GRCm39) missense probably benign
R8448:Ints2 UTSW 11 86,146,249 (GRCm39) missense probably benign
R8784:Ints2 UTSW 11 86,115,941 (GRCm39) nonsense probably null
R8784:Ints2 UTSW 11 86,112,963 (GRCm39) missense probably damaging 1.00
R8942:Ints2 UTSW 11 86,103,720 (GRCm39) missense probably benign 0.00
R9037:Ints2 UTSW 11 86,106,530 (GRCm39) missense probably benign
R9154:Ints2 UTSW 11 86,125,524 (GRCm39) missense probably damaging 1.00
R9397:Ints2 UTSW 11 86,135,311 (GRCm39) missense probably benign 0.01
R9412:Ints2 UTSW 11 86,117,589 (GRCm39) missense probably damaging 0.99
R9472:Ints2 UTSW 11 86,133,824 (GRCm39) missense
R9476:Ints2 UTSW 11 86,135,335 (GRCm39) missense probably benign
R9510:Ints2 UTSW 11 86,135,335 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCCCGTGCATTATCAAAGC -3'
(R):5'- CTGCTAACTGGGAAGTTTTCTAATG -3'

Sequencing Primer
(F):5'- TCCCCGTGCATTATCAAAGCTATAC -3'
(R):5'- TAGCTTCAGTGAAAAAGTAGCTGTG -3'
Posted On 2018-02-27