Incidental Mutation 'R6209:Gaa'
ID503355
Institutional Source Beutler Lab
Gene Symbol Gaa
Ensembl Gene ENSMUSG00000025579
Gene Nameglucosidase, alpha, acid
SynonymsE430018M07Rik
MMRRC Submission 044343-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.460) question?
Stock #R6209 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location119267887-119285454 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 119281171 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 700 (A700D)
Ref Sequence ENSEMBL: ENSMUSP00000101866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026666] [ENSMUST00000106259] [ENSMUST00000132706]
Predicted Effect probably benign
Transcript: ENSMUST00000026666
AA Change: A700D

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000026666
Gene: ENSMUSG00000025579
AA Change: A700D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Pfam:Gal_mutarotas_2 254 320 3.7e-12 PFAM
Pfam:Glyco_hydro_31 340 825 8.8e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106259
AA Change: A700D

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101866
Gene: ENSMUSG00000025579
AA Change: A700D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Pfam:NtCtMGAM_N 147 253 3.5e-32 PFAM
Pfam:Gal_mutarotas_2 254 320 6.5e-12 PFAM
Pfam:Glyco_hydro_31 340 825 1.8e-153 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132706
SMART Domains Protein: ENSMUSP00000119702
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 46 269 2.9e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138510
Predicted Effect unknown
Transcript: ENSMUST00000143288
AA Change: A176D
SMART Domains Protein: ENSMUSP00000121984
Gene: ENSMUSG00000025579
AA Change: A176D

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 8 207 2.2e-67 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a lysosomal acid glucosidase that is involved in the degradation of glycogen. The encoded preproprotein undergoes proteolytic processing to generate a mature enzyme that cleaves alpha-1-4 and alpha-1-6 glycosidic bonds of glycogen, maltose and intermediate oligosaccharides within the lysosome. Mice lacking the encoded protein exhibit symptoms similar to human Pompe syndrome such as accumulation of glycogen in cardiac and skeletal muscle lysosomes resulting in reduced mobility and strength. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to massive glycogen accumulation in multiple organs, cardiomyopathy, hypoactivity, severe motor disability, profound muscle weakness and wasting, and progressive kyphosis. The age of onset and clinical course ofthe disease appear to be strain-dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 T A 1: 38,193,589 M990L probably benign Het
Agl A T 3: 116,785,196 Y429* probably null Het
Ahnak A T 19: 9,012,566 K3738M probably damaging Het
AI481877 A G 4: 59,043,869 *1482R probably null Het
Amn G T 12: 111,275,411 V304L probably damaging Het
Ap3s1 G A 18: 46,779,251 V113I probably benign Het
Arhgef28 A T 13: 97,929,409 probably null Het
Atad2 A G 15: 58,118,415 S18P probably damaging Het
C4b T A 17: 34,741,087 E305V possibly damaging Het
Caskin1 T C 17: 24,507,121 S1401P possibly damaging Het
Cblc A T 7: 19,785,305 V366D possibly damaging Het
Ccdc129 T A 6: 55,874,321 I62N probably damaging Het
Cdk17 A T 10: 93,208,231 T11S probably benign Het
Cenpc1 A G 5: 86,033,650 S619P probably benign Het
Clec4d T G 6: 123,270,529 probably null Het
Disp2 T C 2: 118,786,921 L132P probably damaging Het
Dync2h1 T C 9: 7,165,677 K528R probably benign Het
Fbxw26 A G 9: 109,717,965 I464T possibly damaging Het
Gabbr2 A G 4: 46,804,069 V262A probably damaging Het
Galnt17 T A 5: 131,081,596 M302L probably benign Het
Gm5096 C T 18: 87,757,217 A288V probably damaging Het
Gpn3 T C 5: 122,382,112 I243T probably benign Het
Gpr160 T C 3: 30,895,992 V71A possibly damaging Het
Gramd1b G T 9: 40,333,650 A154D probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
H60b C A 10: 22,287,144 T206N probably benign Het
Hydin A T 8: 110,593,802 I4493F probably benign Het
Il19 C T 1: 130,939,115 E43K possibly damaging Het
Ints2 A G 11: 86,225,058 Y782H probably damaging Het
Jph1 C A 1: 17,097,586 D7Y probably damaging Het
Lipo2 T C 19: 33,749,452 I62V probably damaging Het
Map7 G A 10: 20,276,280 probably null Het
Matk T G 10: 81,259,588 W81G probably damaging Het
Matn4 T C 2: 164,400,815 Y121C probably damaging Het
Mical2 G A 7: 112,324,086 probably null Het
Miga2 T G 2: 30,381,662 Y399D probably damaging Het
Mocos A T 18: 24,666,615 E302V probably benign Het
Mrpl11 C T 19: 4,964,715 A172V probably damaging Het
Mrpl48 A C 7: 100,559,794 Y108D probably damaging Het
Mtr A G 13: 12,190,392 S1061P probably benign Het
Myh11 T A 16: 14,208,291 K1309* probably null Het
Myom2 G A 8: 15,104,173 V704I possibly damaging Het
Nars2 A G 7: 97,057,521 H413R probably benign Het
Nckap1 A G 2: 80,525,602 L619P probably damaging Het
Notch1 T C 2: 26,472,805 N983S probably damaging Het
Nup210 A G 6: 91,025,355 V717A probably benign Het
P4ha3 G T 7: 100,317,085 G479V probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phf11a A G 14: 59,287,579 S59P probably damaging Het
Phyhip G A 14: 70,463,358 S95N probably benign Het
Ppat A G 5: 76,918,146 V375A probably benign Het
Prkdc A G 16: 15,790,592 E3086G probably damaging Het
Psg22 A G 7: 18,719,674 E98G probably damaging Het
Rabgap1 A T 2: 37,563,598 K1013* probably null Het
Retreg3 C T 11: 101,119,700 G27D probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sema6a A T 18: 47,298,302 probably null Het
Sept10 T C 10: 59,170,848 E349G probably damaging Het
Serpina1c A G 12: 103,897,170 V257A probably damaging Het
Sgpp2 T A 1: 78,390,482 M84K probably damaging Het
Skint11 A G 4: 114,244,710 S116G possibly damaging Het
Slc2a5 G A 4: 150,143,100 V459I probably benign Het
Smarca2 T G 19: 26,771,004 Y126* probably null Het
Stab2 T G 10: 86,923,003 N1024H possibly damaging Het
Svep1 A C 4: 58,128,869 F609L probably benign Het
Tbc1d2 G A 4: 46,614,068 T671I probably damaging Het
Thoc5 T C 11: 4,905,697 I82T probably damaging Het
Tmem173 A T 18: 35,736,102 I178N probably damaging Het
Tmem213 G T 6: 38,115,582 C83F probably damaging Het
Topaz1 G A 9: 122,750,505 D827N possibly damaging Het
Trappc10 C A 10: 78,214,812 G265V possibly damaging Het
Ttn A G 2: 76,709,464 S26066P probably damaging Het
Zfp292 G T 4: 34,809,442 Q1201K probably benign Het
Zfp354a T A 11: 51,060,988 probably null Het
Zfp418 T C 7: 7,182,097 V353A possibly damaging Het
Zfp444 G A 7: 6,189,949 probably benign Het
Zfp503 C A 14: 21,985,710 Q379H probably damaging Het
Zfp804a A G 2: 82,258,118 K764E probably damaging Het
Other mutations in Gaa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Gaa APN 11 119274960 missense probably benign
IGL00780:Gaa APN 11 119274291 splice site probably null
IGL00975:Gaa APN 11 119274683 missense possibly damaging 0.93
IGL01354:Gaa APN 11 119270568 missense probably benign 0.18
IGL01572:Gaa APN 11 119284177 missense probably benign
IGL01634:Gaa APN 11 119274076 missense possibly damaging 0.79
IGL01724:Gaa APN 11 119275121 missense possibly damaging 0.65
IGL01889:Gaa APN 11 119278297 missense probably benign 0.03
IGL02052:Gaa APN 11 119284195 missense possibly damaging 0.76
IGL02173:Gaa APN 11 119274913 missense probably damaging 1.00
IGL02261:Gaa APN 11 119281265 makesense probably null
IGL02337:Gaa APN 11 119277603 missense probably damaging 1.00
IGL02625:Gaa APN 11 119274733 missense probably damaging 1.00
IGL02818:Gaa APN 11 119276848 missense probably damaging 0.97
R0135:Gaa UTSW 11 119278890 missense probably benign 0.00
R0280:Gaa UTSW 11 119284547 missense probably damaging 1.00
R0479:Gaa UTSW 11 119281236 missense possibly damaging 0.95
R1130:Gaa UTSW 11 119274683 missense probably damaging 0.97
R1132:Gaa UTSW 11 119285059 missense probably damaging 0.99
R1146:Gaa UTSW 11 119274904 missense probably damaging 1.00
R1146:Gaa UTSW 11 119274904 missense probably damaging 1.00
R1179:Gaa UTSW 11 119281128 missense probably damaging 0.98
R1464:Gaa UTSW 11 119272984 missense probably benign 0.02
R1464:Gaa UTSW 11 119272984 missense probably benign 0.02
R1475:Gaa UTSW 11 119274316 splice site probably null
R1711:Gaa UTSW 11 119280460 missense probably damaging 1.00
R1817:Gaa UTSW 11 119284498 nonsense probably null
R1828:Gaa UTSW 11 119283272 missense probably damaging 0.99
R2013:Gaa UTSW 11 119284583 splice site probably null
R2126:Gaa UTSW 11 119270282 nonsense probably null
R2179:Gaa UTSW 11 119275058 critical splice acceptor site probably null
R2496:Gaa UTSW 11 119283705 missense possibly damaging 0.53
R2936:Gaa UTSW 11 119283724 missense probably benign 0.02
R4321:Gaa UTSW 11 119270137 missense probably benign 0.20
R4603:Gaa UTSW 11 119278958 missense probably damaging 1.00
R4849:Gaa UTSW 11 119272987 missense possibly damaging 0.95
R5225:Gaa UTSW 11 119276843 missense probably damaging 1.00
R5643:Gaa UTSW 11 119280535 missense possibly damaging 0.96
R5644:Gaa UTSW 11 119280535 missense possibly damaging 0.96
R6074:Gaa UTSW 11 119284186 missense probably benign 0.07
R6154:Gaa UTSW 11 119278352 missense probably damaging 1.00
R6208:Gaa UTSW 11 119281171 missense probably benign 0.01
R6258:Gaa UTSW 11 119281171 missense probably benign 0.01
R6259:Gaa UTSW 11 119281171 missense probably benign 0.01
R6260:Gaa UTSW 11 119281171 missense probably benign 0.01
R7173:Gaa UTSW 11 119278991 missense probably damaging 1.00
R7211:Gaa UTSW 11 119284204 missense possibly damaging 0.80
R7379:Gaa UTSW 11 119283699 missense probably benign
R8011:Gaa UTSW 11 119272936 missense probably benign 0.00
R8135:Gaa UTSW 11 119278384 critical splice donor site probably null
R8192:Gaa UTSW 11 119270409 missense possibly damaging 0.92
R8807:Gaa UTSW 11 119277567 missense probably benign 0.02
X0064:Gaa UTSW 11 119274015 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGACACTTCCTGTTCTAGTG -3'
(R):5'- GTTGTGAGAACACCCCTAGCAG -3'

Sequencing Primer
(F):5'- GGCAGAAAGGGTTTATTCCATCC -3'
(R):5'- GGAGGGACTTCTCGGGCAC -3'
Posted On2018-02-27