Incidental Mutation 'R6209:Tmem173'
ID 503369
Institutional Source Beutler Lab
Gene Symbol Tmem173
Ensembl Gene ENSMUSG00000024349
Gene Name transmembrane protein 173
Synonyms 2610307O08Rik, MPYS, Sting, ERIS
MMRRC Submission 044343-MU
Accession Numbers

Ncbi RefSeq:NM_028261.1; MGI: 1919762
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6209 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 35733678-35740554 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 35736102 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 178 (I178N)
Ref Sequence ENSEMBL: ENSMUSP00000111393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115728]
AlphaFold Q3TBT3
PDB Structure Immune activator bound to receptor [X-RAY DIFFRACTION]
mSTING/c-di-GMP [X-RAY DIFFRACTION]
mSTING [X-RAY DIFFRACTION]
Crystal structure of mSting in complex with c[G(2',5')pA(3',5')p] [X-RAY DIFFRACTION]
Crystal structure of mSting in complex with c[G(3',5')pA(3',5')p] [X-RAY DIFFRACTION]
Crystal structure of mSting in complex with DMXAA [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000115728
AA Change: I178N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111393
Gene: ENSMUSG00000024349
AA Change: I178N

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
Pfam:TMEM173 44 336 4.7e-125 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype Strain: 3817418; 4939597
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a five transmembrane protein that functions as a major regulator of the innate immune response to viral and bacterial infections. The encoded protein is a pattern recognition receptor that detects cytosolic nucleic acids and transmits signals that activate type I interferon responses. The encoded protein has also been shown to play a role in apoptotic signaling by associating with type II major histocompatibility complex. Mutations in this gene are the cause of infantile-onset STING-associated vasculopathy. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to viral infection and abnormal innate immunity. Mice homozygous for an ENU-induced allele exhibit altered response to bacterial and viral infection. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 T A 1: 38,193,589 M990L probably benign Het
Agl A T 3: 116,785,196 Y429* probably null Het
Ahnak A T 19: 9,012,566 K3738M probably damaging Het
AI481877 A G 4: 59,043,869 *1482R probably null Het
Amn G T 12: 111,275,411 V304L probably damaging Het
Ap3s1 G A 18: 46,779,251 V113I probably benign Het
Arhgef28 A T 13: 97,929,409 probably null Het
Atad2 A G 15: 58,118,415 S18P probably damaging Het
C4b T A 17: 34,741,087 E305V possibly damaging Het
Caskin1 T C 17: 24,507,121 S1401P possibly damaging Het
Cblc A T 7: 19,785,305 V366D possibly damaging Het
Ccdc129 T A 6: 55,874,321 I62N probably damaging Het
Cdk17 A T 10: 93,208,231 T11S probably benign Het
Cenpc1 A G 5: 86,033,650 S619P probably benign Het
Clec4d T G 6: 123,270,529 probably null Het
Disp2 T C 2: 118,786,921 L132P probably damaging Het
Dync2h1 T C 9: 7,165,677 K528R probably benign Het
Fbxw26 A G 9: 109,717,965 I464T possibly damaging Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gabbr2 A G 4: 46,804,069 V262A probably damaging Het
Galnt17 T A 5: 131,081,596 M302L probably benign Het
Gm5096 C T 18: 87,757,217 A288V probably damaging Het
Gpn3 T C 5: 122,382,112 I243T probably benign Het
Gpr160 T C 3: 30,895,992 V71A possibly damaging Het
Gramd1b G T 9: 40,333,650 A154D probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
H60b C A 10: 22,287,144 T206N probably benign Het
Hydin A T 8: 110,593,802 I4493F probably benign Het
Il19 C T 1: 130,939,115 E43K possibly damaging Het
Ints2 A G 11: 86,225,058 Y782H probably damaging Het
Jph1 C A 1: 17,097,586 D7Y probably damaging Het
Lipo2 T C 19: 33,749,452 I62V probably damaging Het
Map7 G A 10: 20,276,280 probably null Het
Matk T G 10: 81,259,588 W81G probably damaging Het
Matn4 T C 2: 164,400,815 Y121C probably damaging Het
Mical2 G A 7: 112,324,086 probably null Het
Miga2 T G 2: 30,381,662 Y399D probably damaging Het
Mocos A T 18: 24,666,615 E302V probably benign Het
Mrpl11 C T 19: 4,964,715 A172V probably damaging Het
Mrpl48 A C 7: 100,559,794 Y108D probably damaging Het
Mtr A G 13: 12,190,392 S1061P probably benign Het
Myh11 T A 16: 14,208,291 K1309* probably null Het
Myom2 G A 8: 15,104,173 V704I possibly damaging Het
Nars2 A G 7: 97,057,521 H413R probably benign Het
Nckap1 A G 2: 80,525,602 L619P probably damaging Het
Notch1 T C 2: 26,472,805 N983S probably damaging Het
Nup210 A G 6: 91,025,355 V717A probably benign Het
P4ha3 G T 7: 100,317,085 G479V probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phf11a A G 14: 59,287,579 S59P probably damaging Het
Phyhip G A 14: 70,463,358 S95N probably benign Het
Ppat A G 5: 76,918,146 V375A probably benign Het
Prkdc A G 16: 15,790,592 E3086G probably damaging Het
Psg22 A G 7: 18,719,674 E98G probably damaging Het
Rabgap1 A T 2: 37,563,598 K1013* probably null Het
Retreg3 C T 11: 101,119,700 G27D probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sema6a A T 18: 47,298,302 probably null Het
Sept10 T C 10: 59,170,848 E349G probably damaging Het
Serpina1c A G 12: 103,897,170 V257A probably damaging Het
Sgpp2 T A 1: 78,390,482 M84K probably damaging Het
Skint11 A G 4: 114,244,710 S116G possibly damaging Het
Slc2a5 G A 4: 150,143,100 V459I probably benign Het
Smarca2 T G 19: 26,771,004 Y126* probably null Het
Stab2 T G 10: 86,923,003 N1024H possibly damaging Het
Svep1 A C 4: 58,128,869 F609L probably benign Het
Tbc1d2 G A 4: 46,614,068 T671I probably damaging Het
Thoc5 T C 11: 4,905,697 I82T probably damaging Het
Tmem213 G T 6: 38,115,582 C83F probably damaging Het
Topaz1 G A 9: 122,750,505 D827N possibly damaging Het
Trappc10 C A 10: 78,214,812 G265V possibly damaging Het
Ttn A G 2: 76,709,464 S26066P probably damaging Het
Zfp292 G T 4: 34,809,442 Q1201K probably benign Het
Zfp354a T A 11: 51,060,988 probably null Het
Zfp418 T C 7: 7,182,097 V353A possibly damaging Het
Zfp444 G A 7: 6,189,949 probably benign Het
Zfp503 C A 14: 21,985,710 Q379H probably damaging Het
Zfp804a A G 2: 82,258,118 K764E probably damaging Het
Other mutations in Tmem173
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Tmem173 APN 18 35734567 missense probably damaging 0.99
R0226:Tmem173 UTSW 18 35739088 missense probably benign
R0388:Tmem173 UTSW 18 35735111 splice site probably null
R0924:Tmem173 UTSW 18 35735101 critical splice donor site probably null
R2102:Tmem173 UTSW 18 35735237 missense probably damaging 1.00
R4159:Tmem173 UTSW 18 35739219 missense probably damaging 1.00
R4604:Tmem173 UTSW 18 35738690 missense probably damaging 0.97
R6866:Tmem173 UTSW 18 35739429 missense probably damaging 0.97
R7008:Tmem173 UTSW 18 35735171 missense probably damaging 1.00
R7083:Tmem173 UTSW 18 35734650 missense probably damaging 1.00
R7492:Tmem173 UTSW 18 35738713 missense probably damaging 1.00
R7726:Tmem173 UTSW 18 35735265 missense probably damaging 1.00
R7899:Tmem173 UTSW 18 35734573 missense probably damaging 1.00
R8424:Tmem173 UTSW 18 35739170 missense probably benign 0.10
R9084:Tmem173 UTSW 18 35736102 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTTGATGCCAGCACGGTC -3'
(R):5'- AGTGGTGGTAGGGACTGAC -3'

Sequencing Primer
(F):5'- CCAGCACGGTCGATGTTTTGC -3'
(R):5'- GGAAAGCAGACCTTCACATGTTCATG -3'
Posted On 2018-02-27