Incidental Mutation 'R6209:Ap3s1'
ID503371
Institutional Source Beutler Lab
Gene Symbol Ap3s1
Ensembl Gene ENSMUSG00000024480
Gene Nameadaptor-related protein complex 3, sigma 1 subunit
Synonyms[s]3A
MMRRC Submission 044343-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6209 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location46741876-46790826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46779251 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 113 (V113I)
Ref Sequence ENSEMBL: ENSMUSP00000153510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025357] [ENSMUST00000224622] [ENSMUST00000225415] [ENSMUST00000225520] [ENSMUST00000226108]
Predicted Effect probably benign
Transcript: ENSMUST00000025357
AA Change: V113I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025357
Gene: ENSMUSG00000024480
AA Change: V113I

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 148 1.4e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224622
AA Change: V113I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000225415
Predicted Effect probably benign
Transcript: ENSMUST00000225520
AA Change: V113I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000226108
AA Change: V113I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the sigma subunit of the heterotetrameric adaptor protein complex AP-3 which is involved in the formation of specialized lysosome-related compartments such as melanosomes. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. Pseudogenes of this gene are found on chromosomes 1, 8, 16, 17 and X. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 T A 1: 38,193,589 M990L probably benign Het
Agl A T 3: 116,785,196 Y429* probably null Het
Ahnak A T 19: 9,012,566 K3738M probably damaging Het
AI481877 A G 4: 59,043,869 *1482R probably null Het
Amn G T 12: 111,275,411 V304L probably damaging Het
Arhgef28 A T 13: 97,929,409 probably null Het
Atad2 A G 15: 58,118,415 S18P probably damaging Het
C4b T A 17: 34,741,087 E305V possibly damaging Het
Caskin1 T C 17: 24,507,121 S1401P possibly damaging Het
Cblc A T 7: 19,785,305 V366D possibly damaging Het
Ccdc129 T A 6: 55,874,321 I62N probably damaging Het
Cdk17 A T 10: 93,208,231 T11S probably benign Het
Cenpc1 A G 5: 86,033,650 S619P probably benign Het
Clec4d T G 6: 123,270,529 probably null Het
Disp2 T C 2: 118,786,921 L132P probably damaging Het
Dync2h1 T C 9: 7,165,677 K528R probably benign Het
Fbxw26 A G 9: 109,717,965 I464T possibly damaging Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gabbr2 A G 4: 46,804,069 V262A probably damaging Het
Galnt17 T A 5: 131,081,596 M302L probably benign Het
Gm5096 C T 18: 87,757,217 A288V probably damaging Het
Gpn3 T C 5: 122,382,112 I243T probably benign Het
Gpr160 T C 3: 30,895,992 V71A possibly damaging Het
Gramd1b G T 9: 40,333,650 A154D probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
H60b C A 10: 22,287,144 T206N probably benign Het
Hydin A T 8: 110,593,802 I4493F probably benign Het
Il19 C T 1: 130,939,115 E43K possibly damaging Het
Ints2 A G 11: 86,225,058 Y782H probably damaging Het
Jph1 C A 1: 17,097,586 D7Y probably damaging Het
Lipo2 T C 19: 33,749,452 I62V probably damaging Het
Map7 G A 10: 20,276,280 probably null Het
Matk T G 10: 81,259,588 W81G probably damaging Het
Matn4 T C 2: 164,400,815 Y121C probably damaging Het
Mical2 G A 7: 112,324,086 probably null Het
Miga2 T G 2: 30,381,662 Y399D probably damaging Het
Mocos A T 18: 24,666,615 E302V probably benign Het
Mrpl11 C T 19: 4,964,715 A172V probably damaging Het
Mrpl48 A C 7: 100,559,794 Y108D probably damaging Het
Mtr A G 13: 12,190,392 S1061P probably benign Het
Myh11 T A 16: 14,208,291 K1309* probably null Het
Myom2 G A 8: 15,104,173 V704I possibly damaging Het
Nars2 A G 7: 97,057,521 H413R probably benign Het
Nckap1 A G 2: 80,525,602 L619P probably damaging Het
Notch1 T C 2: 26,472,805 N983S probably damaging Het
Nup210 A G 6: 91,025,355 V717A probably benign Het
P4ha3 G T 7: 100,317,085 G479V probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phf11a A G 14: 59,287,579 S59P probably damaging Het
Phyhip G A 14: 70,463,358 S95N probably benign Het
Ppat A G 5: 76,918,146 V375A probably benign Het
Prkdc A G 16: 15,790,592 E3086G probably damaging Het
Psg22 A G 7: 18,719,674 E98G probably damaging Het
Rabgap1 A T 2: 37,563,598 K1013* probably null Het
Retreg3 C T 11: 101,119,700 G27D probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sema6a A T 18: 47,298,302 probably null Het
Sept10 T C 10: 59,170,848 E349G probably damaging Het
Serpina1c A G 12: 103,897,170 V257A probably damaging Het
Sgpp2 T A 1: 78,390,482 M84K probably damaging Het
Skint11 A G 4: 114,244,710 S116G possibly damaging Het
Slc2a5 G A 4: 150,143,100 V459I probably benign Het
Smarca2 T G 19: 26,771,004 Y126* probably null Het
Stab2 T G 10: 86,923,003 N1024H possibly damaging Het
Svep1 A C 4: 58,128,869 F609L probably benign Het
Tbc1d2 G A 4: 46,614,068 T671I probably damaging Het
Thoc5 T C 11: 4,905,697 I82T probably damaging Het
Tmem173 A T 18: 35,736,102 I178N probably damaging Het
Tmem213 G T 6: 38,115,582 C83F probably damaging Het
Topaz1 G A 9: 122,750,505 D827N possibly damaging Het
Trappc10 C A 10: 78,214,812 G265V possibly damaging Het
Ttn A G 2: 76,709,464 S26066P probably damaging Het
Zfp292 G T 4: 34,809,442 Q1201K probably benign Het
Zfp354a T A 11: 51,060,988 probably null Het
Zfp418 T C 7: 7,182,097 V353A possibly damaging Het
Zfp444 G A 7: 6,189,949 probably benign Het
Zfp503 C A 14: 21,985,710 Q379H probably damaging Het
Zfp804a A G 2: 82,258,118 K764E probably damaging Het
Other mutations in Ap3s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0087:Ap3s1 UTSW 18 46758039 missense probably damaging 1.00
R0410:Ap3s1 UTSW 18 46779212 missense probably benign 0.02
R2102:Ap3s1 UTSW 18 46754402 missense possibly damaging 0.88
R4234:Ap3s1 UTSW 18 46779200 missense probably benign 0.28
R4500:Ap3s1 UTSW 18 46790000 missense possibly damaging 0.47
R4894:Ap3s1 UTSW 18 46758116 critical splice donor site probably null
R5081:Ap3s1 UTSW 18 46754430 missense probably benign 0.01
R6063:Ap3s1 UTSW 18 46754438 missense probably benign 0.02
R6250:Ap3s1 UTSW 18 46754447 missense probably damaging 1.00
R6401:Ap3s1 UTSW 18 46758007 missense probably benign 0.00
R6575:Ap3s1 UTSW 18 46754381 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGAGGAGGCCTTATGTGAATG -3'
(R):5'- CAGGGCATACACAGTCTTACTC -3'

Sequencing Primer
(F):5'- TGATTGTTCAAAAGAAGGTTCTGG -3'
(R):5'- ACTCTTTTACTTCAAGCACAGTGG -3'
Posted On2018-02-27