Incidental Mutation 'R6209:Smarca2'
ID503376
Institutional Source Beutler Lab
Gene Symbol Smarca2
Ensembl Gene ENSMUSG00000024921
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
SynonymsSnf2l2, brm, 2610209L14Rik
MMRRC Submission 044343-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6209 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location26605050-26778322 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 26771004 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 126 (Y126*)
Ref Sequence ENSEMBL: ENSMUSP00000146994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025862] [ENSMUST00000099537] [ENSMUST00000112637] [ENSMUST00000175791] [ENSMUST00000175842] [ENSMUST00000175953] [ENSMUST00000176030] [ENSMUST00000176475] [ENSMUST00000176698] [ENSMUST00000176731] [ENSMUST00000176769] [ENSMUST00000177252] [ENSMUST00000207054] [ENSMUST00000207118] [ENSMUST00000207812] [ENSMUST00000207832] [ENSMUST00000208027] [ENSMUST00000208091] [ENSMUST00000208186] [ENSMUST00000208589] [ENSMUST00000208705] [ENSMUST00000208712] [ENSMUST00000208751] [ENSMUST00000209085] [ENSMUST00000208915] [ENSMUST00000208541] [ENSMUST00000208226]
Predicted Effect probably null
Transcript: ENSMUST00000025862
AA Change: Y1433*
SMART Domains Protein: ENSMUSP00000025862
Gene: ENSMUSG00000024921
AA Change: Y1433*

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 8e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
BROMO 1391 1501 3.13e-41 SMART
low complexity region 1502 1524 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1564 1576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099537
SMART Domains Protein: ENSMUSP00000097135
Gene: ENSMUSG00000024921

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 7e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
PDB:2DAT|A 1389 1410 1e-6 PDB
low complexity region 1480 1508 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112637
AA Change: Y86*
SMART Domains Protein: ENSMUSP00000108256
Gene: ENSMUSG00000024921
AA Change: Y86*

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
BROMO 44 154 3.13e-41 SMART
low complexity region 155 177 N/A INTRINSIC
low complexity region 179 193 N/A INTRINSIC
low complexity region 217 229 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000175791
AA Change: Y104*
SMART Domains Protein: ENSMUSP00000135412
Gene: ENSMUSG00000024921
AA Change: Y104*

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
BROMO 44 172 1.74e-39 SMART
low complexity region 173 195 N/A INTRINSIC
low complexity region 197 211 N/A INTRINSIC
low complexity region 235 247 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000175842
AA Change: Y126*
SMART Domains Protein: ENSMUSP00000135800
Gene: ENSMUSG00000024921
AA Change: Y126*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 37 59 N/A INTRINSIC
BROMO 84 212 1.74e-39 SMART
low complexity region 213 235 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000175953
AA Change: Y86*
SMART Domains Protein: ENSMUSP00000135042
Gene: ENSMUSG00000024921
AA Change: Y86*

DomainStartEndE-ValueType
SCOP:d1jb0a_ 16 80 5e-3 SMART
PDB:2DAT|A 42 83 3e-23 PDB
Blast:BROMO 44 83 3e-21 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000176030
AA Change: Y1451*
SMART Domains Protein: ENSMUSP00000135784
Gene: ENSMUSG00000024921
AA Change: Y1451*

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 8e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
BROMO 1391 1519 1.74e-39 SMART
low complexity region 1520 1542 N/A INTRINSIC
low complexity region 1544 1558 N/A INTRINSIC
low complexity region 1582 1594 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176475
AA Change: Y126*
SMART Domains Protein: ENSMUSP00000135248
Gene: ENSMUSG00000024921
AA Change: Y126*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 37 59 N/A INTRINSIC
BROMO 84 194 3.13e-41 SMART
low complexity region 195 217 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
low complexity region 257 269 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176698
AA Change: Y104*
SMART Domains Protein: ENSMUSP00000134914
Gene: ENSMUSG00000024921
AA Change: Y104*

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
BROMO 44 172 1.74e-39 SMART
low complexity region 173 195 N/A INTRINSIC
low complexity region 197 211 N/A INTRINSIC
low complexity region 235 247 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176700
Predicted Effect probably benign
Transcript: ENSMUST00000176731
SMART Domains Protein: ENSMUSP00000135460
Gene: ENSMUSG00000024921

DomainStartEndE-ValueType
PDB:2DAT|A 10 33 8e-9 PDB
Blast:BROMO 12 35 6e-7 BLAST
low complexity region 83 111 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176769
AA Change: Y1375*
SMART Domains Protein: ENSMUSP00000135017
Gene: ENSMUSG00000024921
AA Change: Y1375*

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 908 4.18e-24 SMART
low complexity region 947 956 N/A INTRINSIC
HELICc 1033 1117 3.84e-23 SMART
low complexity region 1175 1190 N/A INTRINSIC
SnAC 1211 1279 7.29e-28 SMART
low complexity region 1286 1308 N/A INTRINSIC
BROMO 1333 1443 3.13e-41 SMART
low complexity region 1444 1466 N/A INTRINSIC
low complexity region 1468 1482 N/A INTRINSIC
low complexity region 1506 1518 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177048
Predicted Effect probably null
Transcript: ENSMUST00000177252
AA Change: Y86*
SMART Domains Protein: ENSMUSP00000134995
Gene: ENSMUSG00000024921
AA Change: Y86*

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
BROMO 44 154 3.13e-41 SMART
low complexity region 155 177 N/A INTRINSIC
low complexity region 179 193 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000207054
AA Change: Y128*
Predicted Effect probably null
Transcript: ENSMUST00000207118
AA Change: Y126*
Predicted Effect probably null
Transcript: ENSMUST00000207812
AA Change: Y126*
Predicted Effect probably null
Transcript: ENSMUST00000207832
AA Change: Y126*
Predicted Effect probably null
Transcript: ENSMUST00000208027
AA Change: Y144*
Predicted Effect probably null
Transcript: ENSMUST00000208091
AA Change: Y110*
Predicted Effect probably null
Transcript: ENSMUST00000208186
AA Change: Y144*
Predicted Effect probably null
Transcript: ENSMUST00000208589
AA Change: Y86*
Predicted Effect probably null
Transcript: ENSMUST00000208674
AA Change: Y214*
Predicted Effect probably null
Transcript: ENSMUST00000208705
AA Change: Y104*
Predicted Effect probably null
Transcript: ENSMUST00000208712
AA Change: Y86*
Predicted Effect probably null
Transcript: ENSMUST00000208751
AA Change: Y86*
Predicted Effect probably null
Transcript: ENSMUST00000209085
AA Change: Y126*
Predicted Effect unknown
Transcript: ENSMUST00000207535
AA Change: M91R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177484
SMART Domains Protein: ENSMUSP00000135869
Gene: ENSMUSG00000024921

DomainStartEndE-ValueType
PDB:2DAT|A 1 33 4e-17 PDB
Blast:BROMO 1 37 1e-18 BLAST
SCOP:d1e6ia_ 1 43 3e-5 SMART
low complexity region 62 76 N/A INTRINSIC
low complexity region 100 112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207418
Predicted Effect probably benign
Transcript: ENSMUST00000208541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177116
SMART Domains Protein: ENSMUSP00000135116
Gene: ENSMUSG00000024921

DomainStartEndE-ValueType
PDB:2DAT|A 1 33 4e-17 PDB
Blast:BROMO 1 37 1e-18 BLAST
SCOP:d1e6ia_ 1 43 3e-5 SMART
low complexity region 62 76 N/A INTRINSIC
low complexity region 100 112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207944
Predicted Effect probably benign
Transcript: ENSMUST00000208226
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene may exhibit infertility and a slightly increased body weight in some genetic backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 T A 1: 38,193,589 M990L probably benign Het
Agl A T 3: 116,785,196 Y429* probably null Het
Ahnak A T 19: 9,012,566 K3738M probably damaging Het
AI481877 A G 4: 59,043,869 *1482R probably null Het
Amn G T 12: 111,275,411 V304L probably damaging Het
Ap3s1 G A 18: 46,779,251 V113I probably benign Het
Arhgef28 A T 13: 97,929,409 probably null Het
Atad2 A G 15: 58,118,415 S18P probably damaging Het
C4b T A 17: 34,741,087 E305V possibly damaging Het
Caskin1 T C 17: 24,507,121 S1401P possibly damaging Het
Cblc A T 7: 19,785,305 V366D possibly damaging Het
Ccdc129 T A 6: 55,874,321 I62N probably damaging Het
Cdk17 A T 10: 93,208,231 T11S probably benign Het
Cenpc1 A G 5: 86,033,650 S619P probably benign Het
Clec4d T G 6: 123,270,529 probably null Het
Disp2 T C 2: 118,786,921 L132P probably damaging Het
Dync2h1 T C 9: 7,165,677 K528R probably benign Het
Fbxw26 A G 9: 109,717,965 I464T possibly damaging Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gabbr2 A G 4: 46,804,069 V262A probably damaging Het
Galnt17 T A 5: 131,081,596 M302L probably benign Het
Gm5096 C T 18: 87,757,217 A288V probably damaging Het
Gpn3 T C 5: 122,382,112 I243T probably benign Het
Gpr160 T C 3: 30,895,992 V71A possibly damaging Het
Gramd1b G T 9: 40,333,650 A154D probably damaging Het
Grid2ip G A 5: 143,380,429 S379N probably damaging Het
H60b C A 10: 22,287,144 T206N probably benign Het
Hydin A T 8: 110,593,802 I4493F probably benign Het
Il19 C T 1: 130,939,115 E43K possibly damaging Het
Ints2 A G 11: 86,225,058 Y782H probably damaging Het
Jph1 C A 1: 17,097,586 D7Y probably damaging Het
Lipo2 T C 19: 33,749,452 I62V probably damaging Het
Map7 G A 10: 20,276,280 probably null Het
Matk T G 10: 81,259,588 W81G probably damaging Het
Matn4 T C 2: 164,400,815 Y121C probably damaging Het
Mical2 G A 7: 112,324,086 probably null Het
Miga2 T G 2: 30,381,662 Y399D probably damaging Het
Mocos A T 18: 24,666,615 E302V probably benign Het
Mrpl11 C T 19: 4,964,715 A172V probably damaging Het
Mrpl48 A C 7: 100,559,794 Y108D probably damaging Het
Mtr A G 13: 12,190,392 S1061P probably benign Het
Myh11 T A 16: 14,208,291 K1309* probably null Het
Myom2 G A 8: 15,104,173 V704I possibly damaging Het
Nars2 A G 7: 97,057,521 H413R probably benign Het
Nckap1 A G 2: 80,525,602 L619P probably damaging Het
Notch1 T C 2: 26,472,805 N983S probably damaging Het
Nup210 A G 6: 91,025,355 V717A probably benign Het
P4ha3 G T 7: 100,317,085 G479V probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Phf11a A G 14: 59,287,579 S59P probably damaging Het
Phyhip G A 14: 70,463,358 S95N probably benign Het
Ppat A G 5: 76,918,146 V375A probably benign Het
Prkdc A G 16: 15,790,592 E3086G probably damaging Het
Psg22 A G 7: 18,719,674 E98G probably damaging Het
Rabgap1 A T 2: 37,563,598 K1013* probably null Het
Retreg3 C T 11: 101,119,700 G27D probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Sema6a A T 18: 47,298,302 probably null Het
Sept10 T C 10: 59,170,848 E349G probably damaging Het
Serpina1c A G 12: 103,897,170 V257A probably damaging Het
Sgpp2 T A 1: 78,390,482 M84K probably damaging Het
Skint11 A G 4: 114,244,710 S116G possibly damaging Het
Slc2a5 G A 4: 150,143,100 V459I probably benign Het
Stab2 T G 10: 86,923,003 N1024H possibly damaging Het
Svep1 A C 4: 58,128,869 F609L probably benign Het
Tbc1d2 G A 4: 46,614,068 T671I probably damaging Het
Thoc5 T C 11: 4,905,697 I82T probably damaging Het
Tmem173 A T 18: 35,736,102 I178N probably damaging Het
Tmem213 G T 6: 38,115,582 C83F probably damaging Het
Topaz1 G A 9: 122,750,505 D827N possibly damaging Het
Trappc10 C A 10: 78,214,812 G265V possibly damaging Het
Ttn A G 2: 76,709,464 S26066P probably damaging Het
Zfp292 G T 4: 34,809,442 Q1201K probably benign Het
Zfp354a T A 11: 51,060,988 probably null Het
Zfp418 T C 7: 7,182,097 V353A possibly damaging Het
Zfp444 G A 7: 6,189,949 probably benign Het
Zfp503 C A 14: 21,985,710 Q379H probably damaging Het
Zfp804a A G 2: 82,258,118 K764E probably damaging Het
Other mutations in Smarca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Smarca2 APN 19 26774294 missense possibly damaging 0.82
IGL01907:Smarca2 APN 19 26698465 missense possibly damaging 0.59
IGL02039:Smarca2 APN 19 26716137 missense probably damaging 1.00
IGL02110:Smarca2 APN 19 26672740 missense possibly damaging 0.96
IGL02561:Smarca2 APN 19 26716182 missense possibly damaging 0.92
IGL02649:Smarca2 APN 19 26640586 missense possibly damaging 0.73
IGL02880:Smarca2 APN 19 26676624 splice site probably benign
IGL03028:Smarca2 APN 19 26678312 splice site probably benign
IGL03187:Smarca2 APN 19 26672824 missense probably damaging 0.98
IGL03213:Smarca2 APN 19 26623975 missense probably damaging 1.00
IGL03354:Smarca2 APN 19 26619903 missense probably benign 0.01
kraft UTSW 19 26678363 missense probably damaging 0.99
R0306_smarca2_828 UTSW 19 26640613 missense probably damaging 1.00
R3845_Smarca2_354 UTSW 19 26720873 missense probably benign 0.06
R6589_smarca2_543 UTSW 19 26619884 missense possibly damaging 0.53
Samarkand UTSW 19 26654464 nonsense probably null
FR4737:Smarca2 UTSW 19 26630999 unclassified probably benign
PIT1430001:Smarca2 UTSW 19 26649093 missense probably benign 0.35
R0184:Smarca2 UTSW 19 26692249 nonsense probably null
R0306:Smarca2 UTSW 19 26640613 missense probably damaging 1.00
R0538:Smarca2 UTSW 19 26691362 missense probably damaging 0.99
R0565:Smarca2 UTSW 19 26681875 missense possibly damaging 0.71
R0610:Smarca2 UTSW 19 26691391 missense probably damaging 1.00
R0669:Smarca2 UTSW 19 26706200 missense possibly damaging 0.51
R0726:Smarca2 UTSW 19 26698403 missense probably damaging 1.00
R1184:Smarca2 UTSW 19 26770933 splice site probably benign
R1256:Smarca2 UTSW 19 26681973 missense probably benign 0.06
R1299:Smarca2 UTSW 19 26771611 critical splice donor site probably null
R1306:Smarca2 UTSW 19 26770988 missense possibly damaging 0.81
R1381:Smarca2 UTSW 19 26630828 missense probably damaging 1.00
R1400:Smarca2 UTSW 19 26676740 missense probably damaging 0.98
R1415:Smarca2 UTSW 19 26710684 missense probably null 0.72
R1496:Smarca2 UTSW 19 26631101 missense possibly damaging 0.85
R1582:Smarca2 UTSW 19 26751905 missense probably damaging 0.99
R1666:Smarca2 UTSW 19 26647034 missense possibly damaging 0.65
R1668:Smarca2 UTSW 19 26647034 missense possibly damaging 0.65
R1751:Smarca2 UTSW 19 26640380 splice site probably benign
R1861:Smarca2 UTSW 19 26623884 missense probably benign 0.03
R1962:Smarca2 UTSW 19 26672724 nonsense probably null
R1964:Smarca2 UTSW 19 26672724 nonsense probably null
R1998:Smarca2 UTSW 19 26631093 missense probably benign 0.33
R2014:Smarca2 UTSW 19 26683905 missense possibly damaging 0.86
R2255:Smarca2 UTSW 19 26771038 missense probably benign 0.01
R2392:Smarca2 UTSW 19 26640650 critical splice donor site probably null
R2439:Smarca2 UTSW 19 26691454 critical splice donor site probably null
R3030:Smarca2 UTSW 19 26752029 missense possibly damaging 0.84
R3195:Smarca2 UTSW 19 26683822 missense possibly damaging 0.85
R3430:Smarca2 UTSW 19 26691349 missense probably damaging 1.00
R3710:Smarca2 UTSW 19 26668890 unclassified probably benign
R3845:Smarca2 UTSW 19 26720873 missense probably benign 0.06
R4013:Smarca2 UTSW 19 26683927 splice site probably null
R4014:Smarca2 UTSW 19 26683927 splice site probably null
R4016:Smarca2 UTSW 19 26683927 splice site probably null
R4271:Smarca2 UTSW 19 26720949 critical splice donor site probably null
R4471:Smarca2 UTSW 19 26619877 missense possibly damaging 0.86
R4612:Smarca2 UTSW 19 26776225 missense possibly damaging 0.70
R4730:Smarca2 UTSW 19 26630673 missense probably damaging 1.00
R4755:Smarca2 UTSW 19 26654483 missense possibly damaging 0.86
R4999:Smarca2 UTSW 19 26720855 nonsense probably null
R5015:Smarca2 UTSW 19 26691388 missense possibly damaging 0.86
R5320:Smarca2 UTSW 19 26691372 missense probably damaging 1.00
R5393:Smarca2 UTSW 19 26640429 missense probably benign 0.18
R5503:Smarca2 UTSW 19 26623936 missense probably damaging 0.96
R5503:Smarca2 UTSW 19 26682046 missense possibly damaging 0.93
R5715:Smarca2 UTSW 19 26649122 missense probably benign 0.16
R5790:Smarca2 UTSW 19 26676724 missense probably damaging 1.00
R5874:Smarca2 UTSW 19 26776069 intron probably benign
R6236:Smarca2 UTSW 19 26696213 missense probably benign 0.33
R6291:Smarca2 UTSW 19 26630892 missense probably damaging 1.00
R6292:Smarca2 UTSW 19 26630892 missense probably damaging 1.00
R6325:Smarca2 UTSW 19 26678363 missense probably damaging 0.99
R6544:Smarca2 UTSW 19 26630931 missense probably damaging 1.00
R6572:Smarca2 UTSW 19 26679173 missense possibly damaging 0.71
R6589:Smarca2 UTSW 19 26619884 missense possibly damaging 0.53
R6601:Smarca2 UTSW 19 26654377 missense probably benign 0.30
R6804:Smarca2 UTSW 19 26751886 missense possibly damaging 0.93
R6922:Smarca2 UTSW 19 26691349 missense probably damaging 1.00
R7047:Smarca2 UTSW 19 26669155 missense possibly damaging 0.83
R7213:Smarca2 UTSW 19 26647131 missense possibly damaging 0.96
R7257:Smarca2 UTSW 19 26654464 nonsense probably null
R7259:Smarca2 UTSW 19 26654464 nonsense probably null
R7479:Smarca2 UTSW 19 26640487 missense probably benign 0.00
R7512:Smarca2 UTSW 19 26683809 missense possibly damaging 0.51
R8158:Smarca2 UTSW 19 26682048 missense probably benign 0.16
R8182:Smarca2 UTSW 19 26630720 missense probably benign 0.39
R8207:Smarca2 UTSW 19 26676680 missense possibly damaging 0.71
R8467:Smarca2 UTSW 19 26619721 start codon destroyed probably null 0.02
R8527:Smarca2 UTSW 19 26676787 missense probably damaging 0.98
R8784:Smarca2 UTSW 19 26776158 missense probably benign 0.17
R8898:Smarca2 UTSW 19 26630958
RF001:Smarca2 UTSW 19 26630986 unclassified probably benign
RF001:Smarca2 UTSW 19 26631021 unclassified probably benign
RF004:Smarca2 UTSW 19 26631020 unclassified probably benign
RF019:Smarca2 UTSW 19 26631001 unclassified probably benign
RF021:Smarca2 UTSW 19 26630997 unclassified probably benign
RF024:Smarca2 UTSW 19 26631020 unclassified probably benign
RF034:Smarca2 UTSW 19 26631011 unclassified probably benign
RF040:Smarca2 UTSW 19 26631022 unclassified probably benign
RF041:Smarca2 UTSW 19 26631021 unclassified probably benign
RF047:Smarca2 UTSW 19 26631005 unclassified probably benign
RF051:Smarca2 UTSW 19 26630988 unclassified probably benign
X0061:Smarca2 UTSW 19 26720840 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCTCTCATGTGATTGAAGCC -3'
(R):5'- GCAAGCCTTGTGTAGGTCAG -3'

Sequencing Primer
(F):5'- CTCTCATGTGATTGAAGCCAGCATG -3'
(R):5'- TGTAGGTCAGTGGTTAGCAAC -3'
Posted On2018-02-27