Incidental Mutation 'R6210:Nr6a1'
ID503380
Institutional Source Beutler Lab
Gene Symbol Nr6a1
Ensembl Gene ENSMUSG00000063972
Gene Namenuclear receptor subfamily 6, group A, member 1
Synonyms1700113M01Rik, Gcnf, NCNF
MMRRC Submission 044344-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6210 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location38723370-38927688 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 38729497 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 462 (I462S)
Ref Sequence ENSEMBL: ENSMUSP00000108498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076275] [ENSMUST00000112877] [ENSMUST00000168098]
Predicted Effect probably damaging
Transcript: ENSMUST00000076275
AA Change: I462S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075624
Gene: ENSMUSG00000063972
AA Change: I462S

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
ZnF_C4 72 143 9.35e-36 SMART
low complexity region 202 216 N/A INTRINSIC
HOLI 304 466 3.19e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112877
AA Change: I462S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108498
Gene: ENSMUSG00000063972
AA Change: I462S

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
ZnF_C4 72 143 9.35e-36 SMART
low complexity region 202 216 N/A INTRINSIC
HOLI 304 466 3.19e-29 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168098
AA Change: I405S

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126009
Gene: ENSMUSG00000063972
AA Change: I405S

DomainStartEndE-ValueType
ZnF_C4 15 86 9.35e-36 SMART
low complexity region 145 159 N/A INTRINSIC
HOLI 247 409 3.19e-29 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an orphan nuclear receptor which is a member of the nuclear hormone receptor family. Its expression pattern suggests that it may be involved in neurogenesis and germ cell development. The protein can homodimerize and bind DNA, but in vivo targets have not been identified. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for targeted null mutations have cardiovascular abnormalities, defective trunk development, impaired somite formation, failure to turn, open neural tube and hindgut, protrusion of the tailbud outside the yolk sac and die by embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T A 18: 10,706,032 I94F probably damaging Het
Bbox1 A T 2: 110,270,077 D258E probably benign Het
Catsperb A G 12: 101,412,568 probably null Het
Ccdc127 T C 13: 74,356,921 V196A probably benign Het
Cd101 A T 3: 101,018,643 D253E probably damaging Het
Ceacam15 T C 7: 16,673,289 Y101C probably damaging Het
Cep135 C T 5: 76,624,723 L652F probably benign Het
Col5a1 G T 2: 28,032,621 V234L probably benign Het
Cxcr6 T C 9: 123,810,008 S25P possibly damaging Het
D17Wsu92e A T 17: 27,767,986 D255E probably benign Het
Dctn4 C T 18: 60,546,793 Q258* probably null Het
Fmnl2 A T 2: 53,130,445 N1067I possibly damaging Het
Frrs1 A T 3: 116,878,431 K59N probably benign Het
Gpr157 T C 4: 150,101,598 Y206H probably damaging Het
Hephl1 A G 9: 15,090,564 Y161H possibly damaging Het
Hinfp C T 9: 44,298,872 probably null Het
Igf2r A T 17: 12,714,951 N805K probably damaging Het
Itga3 T C 11: 95,068,891 probably benign Het
Itga6 A G 2: 71,834,007 probably null Het
Kcnip1 G A 11: 33,645,600 T30I possibly damaging Het
Lig4 T C 8: 9,971,585 T732A probably benign Het
Lmod3 T A 6: 97,247,301 T520S probably damaging Het
Megf8 G A 7: 25,343,720 V1356I possibly damaging Het
Mical3 C T 6: 121,040,517 probably null Het
Msi1 T C 5: 115,435,476 I8T probably damaging Het
Mug4-ps A T 6: 121,950,317 noncoding transcript Het
Myo1f T A 17: 33,601,070 I783N probably damaging Het
Olfr1056 A G 2: 86,356,358 V8A probably benign Het
Olfr330 C T 11: 58,529,264 A241T probably damaging Het
Pah C A 10: 87,583,561 Q449K probably benign Het
Pced1a A G 2: 130,421,919 V271A probably damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Psg21 A G 7: 18,652,345 Y239H probably damaging Het
Ptprt T C 2: 162,268,029 Y180C probably damaging Het
Raet1d T A 10: 22,370,950 I59N probably damaging Het
Rfx1 T C 8: 84,093,018 L653P probably damaging Het
Rnase2a A G 14: 51,255,674 V78A possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Serbp1 T C 6: 67,272,867 probably benign Het
Tlr1 A T 5: 64,925,286 H649Q probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc6 T A 9: 8,656,730 D719E probably benign Het
Ttc21b A T 2: 66,236,354 S318R probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Uhmk1 T C 1: 170,212,237 Q187R probably damaging Het
Ung C T 5: 114,131,377 A50V probably benign Het
Upk3bl C T 5: 136,059,820 Q103* probably null Het
Usp17le C A 7: 104,769,143 C264F probably damaging Het
Vmn2r105 T A 17: 20,228,496 N140Y probably damaging Het
Vmn2r84 C T 10: 130,386,245 C702Y probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp748 G A 13: 67,540,804 P779L possibly damaging Het
Other mutations in Nr6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01566:Nr6a1 APN 2 38727889 missense probably benign 0.06
IGL02245:Nr6a1 APN 2 38740553 missense probably benign 0.04
IGL03195:Nr6a1 APN 2 38742936 missense probably damaging 1.00
R0270:Nr6a1 UTSW 2 38739020 missense possibly damaging 0.75
R0909:Nr6a1 UTSW 2 38885206 missense probably benign 0.11
R1737:Nr6a1 UTSW 2 38738943 missense probably benign 0.04
R5918:Nr6a1 UTSW 2 38739091 missense probably damaging 1.00
R6311:Nr6a1 UTSW 2 38739071 missense possibly damaging 0.69
R6861:Nr6a1 UTSW 2 38740585 missense possibly damaging 0.71
R6978:Nr6a1 UTSW 2 38872619 missense probably benign
R7566:Nr6a1 UTSW 2 38731073 missense possibly damaging 0.77
R8177:Nr6a1 UTSW 2 38729498 missense probably benign 0.02
R8441:Nr6a1 UTSW 2 38742876 missense probably benign 0.05
R8548:Nr6a1 UTSW 2 38729538 missense probably damaging 1.00
R8548:Nr6a1 UTSW 2 38729539 missense probably damaging 1.00
R8776:Nr6a1 UTSW 2 38760232 missense probably damaging 1.00
R8776-TAIL:Nr6a1 UTSW 2 38760232 missense probably damaging 1.00
R8933:Nr6a1 UTSW 2 38760388 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTCAAGACACAGACACAGGCTG -3'
(R):5'- TTATAAATCTGATGCCACCGCC -3'

Sequencing Primer
(F):5'- AGACACAGGCTGCTCTCGTC -3'
(R):5'- CACAGCTGGAACAACTGA -3'
Posted On2018-02-27