Incidental Mutation 'R6210:Ttc21b'
ID503382
Institutional Source Beutler Lab
Gene Symbol Ttc21b
Ensembl Gene ENSMUSG00000034848
Gene Nametetratricopeptide repeat domain 21B
Synonymsline 158, Thm1, aln, 2410066K11Rik
MMRRC Submission 044344-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6210 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location66184327-66256617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66236354 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 318 (S318R)
Ref Sequence ENSEMBL: ENSMUSP00000131758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102718] [ENSMUST00000125446]
Predicted Effect probably benign
Transcript: ENSMUST00000102718
AA Change: S318R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099779
Gene: ENSMUSG00000034848
AA Change: S318R

DomainStartEndE-ValueType
Blast:TPR 109 141 5e-12 BLAST
Blast:TPR 178 211 3e-12 BLAST
TPR 324 357 4.21e1 SMART
low complexity region 379 390 N/A INTRINSIC
TPR 492 525 8.51e0 SMART
TPR 526 559 5.92e1 SMART
TPR 563 596 7.69e1 SMART
TPR 721 754 3.07e-5 SMART
TPR 755 788 9.45e0 SMART
TPR 790 821 9.24e1 SMART
TPR 830 863 3.05e0 SMART
TPR 883 916 1.55e-1 SMART
TPR 917 950 8.74e0 SMART
TPR 951 984 6.75e1 SMART
Blast:TPR 1023 1054 5e-13 BLAST
Blast:TPR 1156 1189 1e-12 BLAST
TPR 1196 1229 9.7e0 SMART
TPR 1265 1298 1.02e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125446
AA Change: S318R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000131758
Gene: ENSMUSG00000034848
AA Change: S318R

DomainStartEndE-ValueType
Blast:TPR 108 141 3e-12 BLAST
Blast:TPR 178 211 3e-12 BLAST
TPR 324 357 4.21e1 SMART
low complexity region 379 390 N/A INTRINSIC
TPR 492 525 8.51e0 SMART
TPR 526 559 5.92e1 SMART
TPR 563 596 7.69e1 SMART
TPR 721 754 3.07e-5 SMART
TPR 755 788 9.45e0 SMART
TPR 790 821 9.24e1 SMART
TPR 830 863 3.05e0 SMART
TPR 883 916 1.55e-1 SMART
TPR 917 950 8.74e0 SMART
TPR 951 984 6.75e1 SMART
Blast:TPR 1023 1054 4e-13 BLAST
Blast:TPR 1156 1189 9e-13 BLAST
TPR 1196 1229 9.7e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169968
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of TTC21 family, containing several tetratricopeptide repeat (TPR) domains. This protein is localized to the cilium axoneme, and may play a role in retrograde intraflagellar transport in cilia. Mutations in this gene are associated with various ciliopathies, nephronophthisis 12, and asphyxiating thoracic dystrophy 4. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutation of this gene is embryonic lethal. Mutant embryos exhibit several deformities including polydactyly, microphthalmia, irregular shape of the long bones, rib fusion and truncation, neural tube defects, and abnormal brain structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T A 18: 10,706,032 I94F probably damaging Het
Bbox1 A T 2: 110,270,077 D258E probably benign Het
Catsperb A G 12: 101,412,568 probably null Het
Ccdc127 T C 13: 74,356,921 V196A probably benign Het
Cd101 A T 3: 101,018,643 D253E probably damaging Het
Ceacam15 T C 7: 16,673,289 Y101C probably damaging Het
Cep135 C T 5: 76,624,723 L652F probably benign Het
Col5a1 G T 2: 28,032,621 V234L probably benign Het
Cxcr6 T C 9: 123,810,008 S25P possibly damaging Het
D17Wsu92e A T 17: 27,767,986 D255E probably benign Het
Dctn4 C T 18: 60,546,793 Q258* probably null Het
Fmnl2 A T 2: 53,130,445 N1067I possibly damaging Het
Frrs1 A T 3: 116,878,431 K59N probably benign Het
Gpr157 T C 4: 150,101,598 Y206H probably damaging Het
Hephl1 A G 9: 15,090,564 Y161H possibly damaging Het
Hinfp C T 9: 44,298,872 probably null Het
Igf2r A T 17: 12,714,951 N805K probably damaging Het
Itga3 T C 11: 95,068,891 probably benign Het
Itga6 A G 2: 71,834,007 probably null Het
Kcnip1 G A 11: 33,645,600 T30I possibly damaging Het
Lig4 T C 8: 9,971,585 T732A probably benign Het
Lmod3 T A 6: 97,247,301 T520S probably damaging Het
Megf8 G A 7: 25,343,720 V1356I possibly damaging Het
Mical3 C T 6: 121,040,517 probably null Het
Msi1 T C 5: 115,435,476 I8T probably damaging Het
Mug4-ps A T 6: 121,950,317 noncoding transcript Het
Myo1f T A 17: 33,601,070 I783N probably damaging Het
Nr6a1 A C 2: 38,729,497 I462S probably damaging Het
Olfr1056 A G 2: 86,356,358 V8A probably benign Het
Olfr330 C T 11: 58,529,264 A241T probably damaging Het
Pah C A 10: 87,583,561 Q449K probably benign Het
Pced1a A G 2: 130,421,919 V271A probably damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Psg21 A G 7: 18,652,345 Y239H probably damaging Het
Ptprt T C 2: 162,268,029 Y180C probably damaging Het
Raet1d T A 10: 22,370,950 I59N probably damaging Het
Rfx1 T C 8: 84,093,018 L653P probably damaging Het
Rnase2a A G 14: 51,255,674 V78A possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Serbp1 T C 6: 67,272,867 probably benign Het
Tlr1 A T 5: 64,925,286 H649Q probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc6 T A 9: 8,656,730 D719E probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Uhmk1 T C 1: 170,212,237 Q187R probably damaging Het
Ung C T 5: 114,131,377 A50V probably benign Het
Upk3bl C T 5: 136,059,820 Q103* probably null Het
Usp17le C A 7: 104,769,143 C264F probably damaging Het
Vmn2r105 T A 17: 20,228,496 N140Y probably damaging Het
Vmn2r84 C T 10: 130,386,245 C702Y probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp748 G A 13: 67,540,804 P779L possibly damaging Het
Other mutations in Ttc21b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Ttc21b APN 2 66242775 missense probably benign 0.00
IGL00467:Ttc21b APN 2 66188364 missense probably damaging 1.00
IGL00721:Ttc21b APN 2 66226778 missense probably benign 0.06
IGL00837:Ttc21b APN 2 66235571 critical splice donor site probably null
IGL01317:Ttc21b APN 2 66188356 missense probably benign 0.00
IGL01485:Ttc21b APN 2 66251890 splice site probably benign
IGL01739:Ttc21b APN 2 66237856 missense probably benign
IGL02282:Ttc21b APN 2 66191737 missense probably damaging 0.96
IGL02431:Ttc21b APN 2 66251885 splice site probably benign
IGL02478:Ttc21b APN 2 66188280 missense probably benign 0.05
IGL02487:Ttc21b APN 2 66235156 missense probably benign 0.02
IGL03327:Ttc21b APN 2 66237848 missense possibly damaging 0.92
IGL03346:Ttc21b APN 2 66237848 missense possibly damaging 0.92
plus-sized UTSW 2 66242679 missense probably damaging 1.00
R6482_Ttc21b_149 UTSW 2 66226900 missense probably benign 0.12
PIT4696001:Ttc21b UTSW 2 66231219 splice site probably null
R0049:Ttc21b UTSW 2 66223564 missense probably damaging 1.00
R0049:Ttc21b UTSW 2 66223564 missense probably damaging 1.00
R0373:Ttc21b UTSW 2 66188326 missense probably damaging 0.99
R0440:Ttc21b UTSW 2 66236382 missense probably benign 0.03
R0504:Ttc21b UTSW 2 66222798 splice site probably benign
R0600:Ttc21b UTSW 2 66239570 missense probably damaging 0.99
R0621:Ttc21b UTSW 2 66226011 missense probably benign 0.07
R0633:Ttc21b UTSW 2 66236233 missense probably benign
R0863:Ttc21b UTSW 2 66242773 missense probably benign
R1617:Ttc21b UTSW 2 66226035 missense probably benign 0.22
R1837:Ttc21b UTSW 2 66197762 missense probably benign 0.01
R1844:Ttc21b UTSW 2 66223577 nonsense probably null
R2120:Ttc21b UTSW 2 66226754 missense probably benign 0.12
R2205:Ttc21b UTSW 2 66235123 missense possibly damaging 0.51
R2392:Ttc21b UTSW 2 66207450 critical splice donor site probably null
R3689:Ttc21b UTSW 2 66224144 missense probably benign 0.22
R3810:Ttc21b UTSW 2 66252233 critical splice acceptor site probably null
R3847:Ttc21b UTSW 2 66242679 missense probably damaging 1.00
R3897:Ttc21b UTSW 2 66235069 missense probably benign 0.01
R4561:Ttc21b UTSW 2 66186218 missense probably damaging 1.00
R4671:Ttc21b UTSW 2 66226913 missense possibly damaging 0.66
R5161:Ttc21b UTSW 2 66229023 missense probably damaging 0.98
R5274:Ttc21b UTSW 2 66236283 missense possibly damaging 0.89
R5594:Ttc21b UTSW 2 66236235 missense probably benign 0.39
R6305:Ttc21b UTSW 2 66188270 missense probably damaging 0.99
R6456:Ttc21b UTSW 2 66188331 missense probably damaging 0.97
R6482:Ttc21b UTSW 2 66226900 missense probably benign 0.12
R6645:Ttc21b UTSW 2 66236377 missense probably benign 0.01
R6800:Ttc21b UTSW 2 66208650 splice site probably null
R6815:Ttc21b UTSW 2 66226790 missense probably benign 0.00
R6959:Ttc21b UTSW 2 66231312 missense probably benign 0.05
R7125:Ttc21b UTSW 2 66236326 missense probably benign 0.00
R7265:Ttc21b UTSW 2 66210173 missense possibly damaging 0.89
R7283:Ttc21b UTSW 2 66208718 missense probably damaging 0.96
R7560:Ttc21b UTSW 2 66217204 missense possibly damaging 0.69
R7561:Ttc21b UTSW 2 66217204 missense possibly damaging 0.69
R7816:Ttc21b UTSW 2 66247361 missense possibly damaging 0.82
R8172:Ttc21b UTSW 2 66252156 missense probably benign 0.01
R8179:Ttc21b UTSW 2 66201480 missense probably benign
X0013:Ttc21b UTSW 2 66225950 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATTCTCTGCTTGAGTGGGC -3'
(R):5'- CCAGATGATAGAATGAATGCCTTTCC -3'

Sequencing Primer
(F):5'- GCTTGAGTGGGCAGATGC -3'
(R):5'- AGAATGAATGCCTTTCCTTCTTAAG -3'
Posted On2018-02-27