Incidental Mutation 'R6210:Cd101'
ID503389
Institutional Source Beutler Lab
Gene Symbol Cd101
Ensembl Gene ENSMUSG00000086564
Gene NameCD101 antigen
SynonymsIgsf2, LOC381460
MMRRC Submission 044344-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6210 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location100993529-101029556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101018643 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 253 (D253E)
Ref Sequence ENSEMBL: ENSMUSP00000126027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147399] [ENSMUST00000167086]
Predicted Effect probably damaging
Transcript: ENSMUST00000147399
AA Change: D257E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116643
Gene: ENSMUSG00000086564
AA Change: D257E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 28 143 4.96e-8 SMART
IG 153 266 4.74e-5 SMART
IG_like 274 379 2.19e-1 SMART
IG 289 395 3.25e-3 SMART
IG 417 533 4.85e-11 SMART
IG 545 659 1.52e-3 SMART
IG 680 805 3.16e-1 SMART
IG_like 827 927 2.95e-1 SMART
IG 856 955 1.04e-1 SMART
transmembrane domain 971 993 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167086
AA Change: D253E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126027
Gene: ENSMUSG00000086564
AA Change: D253E

DomainStartEndE-ValueType
IG 24 139 4.96e-8 SMART
IG 149 262 4.74e-5 SMART
IG_like 270 375 2.19e-1 SMART
IG 285 391 3.25e-3 SMART
IG 413 529 4.85e-11 SMART
IG 541 655 1.52e-3 SMART
IG 676 801 3.16e-1 SMART
IG_like 823 923 2.95e-1 SMART
IG 852 951 1.04e-1 SMART
transmembrane domain 967 989 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (52/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced Gr-1+ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T A 18: 10,706,032 I94F probably damaging Het
Bbox1 A T 2: 110,270,077 D258E probably benign Het
Catsperb A G 12: 101,412,568 probably null Het
Ccdc127 T C 13: 74,356,921 V196A probably benign Het
Ceacam15 T C 7: 16,673,289 Y101C probably damaging Het
Cep135 C T 5: 76,624,723 L652F probably benign Het
Col5a1 G T 2: 28,032,621 V234L probably benign Het
Cxcr6 T C 9: 123,810,008 S25P possibly damaging Het
D17Wsu92e A T 17: 27,767,986 D255E probably benign Het
Dctn4 C T 18: 60,546,793 Q258* probably null Het
Fmnl2 A T 2: 53,130,445 N1067I possibly damaging Het
Frrs1 A T 3: 116,878,431 K59N probably benign Het
Gpr157 T C 4: 150,101,598 Y206H probably damaging Het
Hephl1 A G 9: 15,090,564 Y161H possibly damaging Het
Hinfp C T 9: 44,298,872 probably null Het
Igf2r A T 17: 12,714,951 N805K probably damaging Het
Itga3 T C 11: 95,068,891 probably benign Het
Itga6 A G 2: 71,834,007 probably null Het
Kcnip1 G A 11: 33,645,600 T30I possibly damaging Het
Lig4 T C 8: 9,971,585 T732A probably benign Het
Lmod3 T A 6: 97,247,301 T520S probably damaging Het
Megf8 G A 7: 25,343,720 V1356I possibly damaging Het
Mical3 C T 6: 121,040,517 probably null Het
Msi1 T C 5: 115,435,476 I8T probably damaging Het
Mug4-ps A T 6: 121,950,317 noncoding transcript Het
Myo1f T A 17: 33,601,070 I783N probably damaging Het
Nr6a1 A C 2: 38,729,497 I462S probably damaging Het
Olfr1056 A G 2: 86,356,358 V8A probably benign Het
Olfr330 C T 11: 58,529,264 A241T probably damaging Het
Pah C A 10: 87,583,561 Q449K probably benign Het
Pced1a A G 2: 130,421,919 V271A probably damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Psg21 A G 7: 18,652,345 Y239H probably damaging Het
Ptprt T C 2: 162,268,029 Y180C probably damaging Het
Raet1d T A 10: 22,370,950 I59N probably damaging Het
Rfx1 T C 8: 84,093,018 L653P probably damaging Het
Rnase2a A G 14: 51,255,674 V78A possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Serbp1 T C 6: 67,272,867 probably benign Het
Tlr1 A T 5: 64,925,286 H649Q probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc6 T A 9: 8,656,730 D719E probably benign Het
Ttc21b A T 2: 66,236,354 S318R probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Uhmk1 T C 1: 170,212,237 Q187R probably damaging Het
Ung C T 5: 114,131,377 A50V probably benign Het
Upk3bl C T 5: 136,059,820 Q103* probably null Het
Usp17le C A 7: 104,769,143 C264F probably damaging Het
Vmn2r105 T A 17: 20,228,496 N140Y probably damaging Het
Vmn2r84 C T 10: 130,386,245 C702Y probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp748 G A 13: 67,540,804 P779L possibly damaging Het
Other mutations in Cd101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Cd101 APN 3 101003702 missense probably damaging 1.00
IGL01443:Cd101 APN 3 101003571 missense probably benign
IGL02000:Cd101 APN 3 101012082 missense probably benign 0.11
IGL02178:Cd101 APN 3 100993766 missense probably damaging 1.00
IGL02224:Cd101 APN 3 101017002 missense probably benign
IGL02450:Cd101 APN 3 100993738 missense probably damaging 0.99
IGL02502:Cd101 APN 3 101011825 missense probably damaging 0.99
IGL02536:Cd101 APN 3 101003597 missense probably damaging 1.00
IGL02749:Cd101 APN 3 101020399 missense probably damaging 1.00
IGL02818:Cd101 APN 3 101011929 missense probably damaging 1.00
IGL02829:Cd101 APN 3 101018565 splice site probably benign
IGL02902:Cd101 APN 3 101018994 splice site probably benign
tax_day UTSW 3 101003705 missense possibly damaging 0.86
R0069:Cd101 UTSW 3 101008217 missense probably benign 0.08
R0069:Cd101 UTSW 3 101008217 missense probably benign 0.08
R0411:Cd101 UTSW 3 101018527 splice site probably null
R0486:Cd101 UTSW 3 101008092 missense possibly damaging 0.94
R0556:Cd101 UTSW 3 101020654 missense probably damaging 1.00
R0726:Cd101 UTSW 3 101020622 missense possibly damaging 0.95
R0966:Cd101 UTSW 3 101008222 missense probably benign 0.13
R1344:Cd101 UTSW 3 101018775 nonsense probably null
R1418:Cd101 UTSW 3 101018775 nonsense probably null
R1547:Cd101 UTSW 3 101018951 missense possibly damaging 0.94
R1551:Cd101 UTSW 3 101012013 missense probably damaging 0.99
R1845:Cd101 UTSW 3 101029448 splice site probably null
R1919:Cd101 UTSW 3 101018917 missense probably damaging 1.00
R1976:Cd101 UTSW 3 101008061 missense probably damaging 0.96
R2260:Cd101 UTSW 3 101016945 missense possibly damaging 0.82
R2679:Cd101 UTSW 3 100993763 missense probably benign 0.00
R2873:Cd101 UTSW 3 101003848 missense probably benign 0.00
R3606:Cd101 UTSW 3 101020597 missense probably damaging 1.00
R4201:Cd101 UTSW 3 101018685 missense probably damaging 1.00
R4202:Cd101 UTSW 3 101018685 missense probably damaging 1.00
R4205:Cd101 UTSW 3 101018685 missense probably damaging 1.00
R4349:Cd101 UTSW 3 101013314 missense possibly damaging 0.93
R4574:Cd101 UTSW 3 101013153 missense probably benign 0.02
R4601:Cd101 UTSW 3 100993888 missense possibly damaging 0.84
R4820:Cd101 UTSW 3 101022155 missense probably benign 0.01
R4910:Cd101 UTSW 3 100993889 missense probably benign 0.13
R5014:Cd101 UTSW 3 101003823 missense probably damaging 0.99
R5081:Cd101 UTSW 3 101003705 missense possibly damaging 0.86
R5396:Cd101 UTSW 3 101018810 missense probably damaging 1.00
R5425:Cd101 UTSW 3 101018686 missense probably damaging 1.00
R6193:Cd101 UTSW 3 101020462 missense probably damaging 1.00
R6732:Cd101 UTSW 3 101008199 missense probably benign 0.01
R6830:Cd101 UTSW 3 100993696 missense probably benign 0.12
R6897:Cd101 UTSW 3 101013060 missense probably damaging 1.00
R6940:Cd101 UTSW 3 101003702 missense probably damaging 1.00
R7335:Cd101 UTSW 3 101018729 missense probably benign 0.01
R7565:Cd101 UTSW 3 101018792 missense probably benign 0.00
R7880:Cd101 UTSW 3 101007866 missense probably benign 0.00
R8121:Cd101 UTSW 3 101020582 missense probably damaging 1.00
R8233:Cd101 UTSW 3 100993673 missense unknown
R8900:Cd101 UTSW 3 101018746 missense probably benign 0.19
R8960:Cd101 UTSW 3 101003501 missense probably benign 0.01
X0018:Cd101 UTSW 3 101018632 missense possibly damaging 0.95
X0023:Cd101 UTSW 3 101018855 missense probably benign
X0058:Cd101 UTSW 3 101020421 missense probably damaging 1.00
Z1177:Cd101 UTSW 3 101011916 missense probably benign 0.03
Z1177:Cd101 UTSW 3 101017140 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGGAACAGAGCCCTAATGG -3'
(R):5'- TCTCCAAGGACTTTGTATTGACC -3'

Sequencing Primer
(F):5'- GGAACATTCTAGAACGTCTTCTTAG -3'
(R):5'- CAAGGACTTTGTATTGACCCCTGG -3'
Posted On2018-02-27