Incidental Mutation 'R6210:Ung'
ID503394
Institutional Source Beutler Lab
Gene Symbol Ung
Ensembl Gene ENSMUSG00000029591
Gene Nameuracil DNA glycosylase
SynonymsUNG1
MMRRC Submission 044344-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.923) question?
Stock #R6210 (G1)
Quality Score186.009
Status Not validated
Chromosome5
Chromosomal Location114130386-114139323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 114131377 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 50 (A50V)
Ref Sequence ENSEMBL: ENSMUSP00000142484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031587] [ENSMUST00000053657] [ENSMUST00000102584] [ENSMUST00000112275] [ENSMUST00000112279] [ENSMUST00000137402] [ENSMUST00000143455] [ENSMUST00000149418]
Predicted Effect probably benign
Transcript: ENSMUST00000031587
AA Change: A61V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000031587
Gene: ENSMUSG00000029591
AA Change: A61V

DomainStartEndE-ValueType
low complexity region 72 81 N/A INTRINSIC
UDG 132 293 5.86e-35 SMART
UreE_C 132 293 5.86e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000053657
SMART Domains Protein: ENSMUSP00000056043
Gene: ENSMUSG00000044339

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:2OG-FeII_Oxy_2 47 232 1.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102584
AA Change: A50V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099644
Gene: ENSMUSG00000029591
AA Change: A50V

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 61 70 N/A INTRINSIC
UDG 121 282 5.86e-35 SMART
UreE_C 121 282 5.86e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112275
SMART Domains Protein: ENSMUSP00000107894
Gene: ENSMUSG00000029591

DomainStartEndE-ValueType
UDG 25 186 5.86e-35 SMART
UreE_C 25 186 5.86e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112279
SMART Domains Protein: ENSMUSP00000107898
Gene: ENSMUSG00000044339

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:2OG-FeII_Oxy_2 47 232 5.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137402
SMART Domains Protein: ENSMUSP00000114140
Gene: ENSMUSG00000029591

DomainStartEndE-ValueType
UDG 35 184 2.05e-25 SMART
UreE_C 35 184 2.05e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143455
AA Change: A50V

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000142484
Gene: ENSMUSG00000029591
AA Change: A50V

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 61 70 N/A INTRINSIC
PDB:2SSP|E 76 127 3e-27 PDB
SCOP:d3euga_ 79 127 1e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200479
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several uracil-DNA glycosylases. One important function of uracil-DNA glycosylases is to prevent mutagenesis by eliminating uracil from DNA molecules by cleaving the N-glycosylic bond and initiating the base-excision repair (BER) pathway. Uracil bases occur from cytosine deamination or misincorporation of dUMP residues. Alternative promoter usage and splicing of this gene leads to two different isoforms: the mitochondrial UNG1 and the nuclear UNG2. The UNG2 term was used as a previous symbol for the CCNO gene (GeneID 10309), which has been confused with this gene, in the literature and some databases. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null mutants incorporate an elevated level of uracil into DNA of dividing cells. In hypermutation at immunoglobulin genes, mutations at C/G pairs are shifted toward transitions, and class-switch recombination is reduced. Homozygous null mutants display increased ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T A 18: 10,706,032 I94F probably damaging Het
Bbox1 A T 2: 110,270,077 D258E probably benign Het
Catsperb A G 12: 101,412,568 probably null Het
Ccdc127 T C 13: 74,356,921 V196A probably benign Het
Cd101 A T 3: 101,018,643 D253E probably damaging Het
Ceacam15 T C 7: 16,673,289 Y101C probably damaging Het
Cep135 C T 5: 76,624,723 L652F probably benign Het
Col5a1 G T 2: 28,032,621 V234L probably benign Het
Cxcr6 T C 9: 123,810,008 S25P possibly damaging Het
D17Wsu92e A T 17: 27,767,986 D255E probably benign Het
Dctn4 C T 18: 60,546,793 Q258* probably null Het
Fmnl2 A T 2: 53,130,445 N1067I possibly damaging Het
Frrs1 A T 3: 116,878,431 K59N probably benign Het
Gpr157 T C 4: 150,101,598 Y206H probably damaging Het
Hephl1 A G 9: 15,090,564 Y161H possibly damaging Het
Hinfp C T 9: 44,298,872 probably null Het
Igf2r A T 17: 12,714,951 N805K probably damaging Het
Itga3 T C 11: 95,068,891 probably benign Het
Itga6 A G 2: 71,834,007 probably null Het
Kcnip1 G A 11: 33,645,600 T30I possibly damaging Het
Lig4 T C 8: 9,971,585 T732A probably benign Het
Lmod3 T A 6: 97,247,301 T520S probably damaging Het
Megf8 G A 7: 25,343,720 V1356I possibly damaging Het
Mical3 C T 6: 121,040,517 probably null Het
Msi1 T C 5: 115,435,476 I8T probably damaging Het
Mug4-ps A T 6: 121,950,317 noncoding transcript Het
Myo1f T A 17: 33,601,070 I783N probably damaging Het
Nr6a1 A C 2: 38,729,497 I462S probably damaging Het
Olfr1056 A G 2: 86,356,358 V8A probably benign Het
Olfr330 C T 11: 58,529,264 A241T probably damaging Het
Pah C A 10: 87,583,561 Q449K probably benign Het
Pced1a A G 2: 130,421,919 V271A probably damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Psg21 A G 7: 18,652,345 Y239H probably damaging Het
Ptprt T C 2: 162,268,029 Y180C probably damaging Het
Raet1d T A 10: 22,370,950 I59N probably damaging Het
Rfx1 T C 8: 84,093,018 L653P probably damaging Het
Rnase2a A G 14: 51,255,674 V78A possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Serbp1 T C 6: 67,272,867 probably benign Het
Tlr1 A T 5: 64,925,286 H649Q probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc6 T A 9: 8,656,730 D719E probably benign Het
Ttc21b A T 2: 66,236,354 S318R probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Uhmk1 T C 1: 170,212,237 Q187R probably damaging Het
Upk3bl C T 5: 136,059,820 Q103* probably null Het
Usp17le C A 7: 104,769,143 C264F probably damaging Het
Vmn2r105 T A 17: 20,228,496 N140Y probably damaging Het
Vmn2r84 C T 10: 130,386,245 C702Y probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp748 G A 13: 67,540,804 P779L possibly damaging Het
Other mutations in Ung
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Ung APN 5 114137308 missense possibly damaging 0.50
IGL01995:Ung APN 5 114136386 missense probably benign 0.30
IGL02084:Ung APN 5 114130576 missense probably benign 0.00
R1219:Ung UTSW 5 114132167 unclassified probably benign
R1617:Ung UTSW 5 114131354 missense probably benign 0.14
R2513:Ung UTSW 5 114137192 missense probably benign 0.11
R4078:Ung UTSW 5 114130623 splice site probably null
R4079:Ung UTSW 5 114130623 splice site probably null
R6258:Ung UTSW 5 114137300 missense probably benign 0.12
R6954:Ung UTSW 5 114131337 missense probably benign 0.25
R7288:Ung UTSW 5 114131254 nonsense probably null
R8944:Ung UTSW 5 114131395 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTTTTGCCGCGAAAAGC -3'
(R):5'- TTGTCAAGTGTGGCACGGAAAG -3'

Sequencing Primer
(F):5'- GCGAAAAGCCTGCGTGG -3'
(R):5'- TGTGGCACGGAAAGGGAGG -3'
Posted On2018-02-27