Incidental Mutation 'R6210:Msi1'
ID503395
Institutional Source Beutler Lab
Gene Symbol Msi1
Ensembl Gene ENSMUSG00000054256
Gene Namemusashi RNA-binding protein 1
Synonymsm-Msi-1, Msi1h, Msi1, Musahi1
MMRRC Submission 044344-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R6210 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location115429599-115455698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115435476 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 8 (I8T)
Ref Sequence ENSEMBL: ENSMUSP00000143900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000136586] [ENSMUST00000150779]
Predicted Effect unknown
Transcript: ENSMUST00000067168
AA Change: I84T
SMART Domains Protein: ENSMUSP00000070415
Gene: ENSMUSG00000054256
AA Change: I84T

DomainStartEndE-ValueType
RRM 2 67 7.47e-14 SMART
RRM 84 156 4e-23 SMART
low complexity region 258 269 N/A INTRINSIC
low complexity region 297 304 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130849
Predicted Effect unknown
Transcript: ENSMUST00000131079
AA Change: I83T
Predicted Effect probably damaging
Transcript: ENSMUST00000136586
AA Change: I8T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143900
Gene: ENSMUSG00000054256
AA Change: I8T

DomainStartEndE-ValueType
RRM 7 79 1.7e-25 SMART
transmembrane domain 102 124 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145840
Predicted Effect possibly damaging
Transcript: ENSMUST00000150779
AA Change: I111T

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120516
Gene: ENSMUSG00000054256
AA Change: I111T

DomainStartEndE-ValueType
RRM 21 93 2e-23 SMART
RRM 110 182 4e-23 SMART
low complexity region 295 306 N/A INTRINSIC
low complexity region 334 341 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202548
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing two conserved tandem RNA recognition motifs. Similar proteins in other species function as RNA-binding proteins and play central roles in posttranscriptional gene regulation. Expression of this gene has been correlated with the grade of the malignancy and proliferative activity in gliomas and melanomas. A pseudogene for this gene is located on chromosome 11q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygous null mice develop hydrocephalus associated with progressive ventricular dilation, a large domed cranium, thin cerebral cortices, callosal agenesis, aberrant proliferation and polyposis of ependymal cells, intracerebral bleeding, ataxia, dehydration and death at 1-2 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T A 18: 10,706,032 I94F probably damaging Het
Bbox1 A T 2: 110,270,077 D258E probably benign Het
Catsperb A G 12: 101,412,568 probably null Het
Ccdc127 T C 13: 74,356,921 V196A probably benign Het
Cd101 A T 3: 101,018,643 D253E probably damaging Het
Ceacam15 T C 7: 16,673,289 Y101C probably damaging Het
Cep135 C T 5: 76,624,723 L652F probably benign Het
Col5a1 G T 2: 28,032,621 V234L probably benign Het
Cxcr6 T C 9: 123,810,008 S25P possibly damaging Het
D17Wsu92e A T 17: 27,767,986 D255E probably benign Het
Dctn4 C T 18: 60,546,793 Q258* probably null Het
Fmnl2 A T 2: 53,130,445 N1067I possibly damaging Het
Frrs1 A T 3: 116,878,431 K59N probably benign Het
Gpr157 T C 4: 150,101,598 Y206H probably damaging Het
Hephl1 A G 9: 15,090,564 Y161H possibly damaging Het
Hinfp C T 9: 44,298,872 probably null Het
Igf2r A T 17: 12,714,951 N805K probably damaging Het
Itga3 T C 11: 95,068,891 probably benign Het
Itga6 A G 2: 71,834,007 probably null Het
Kcnip1 G A 11: 33,645,600 T30I possibly damaging Het
Lig4 T C 8: 9,971,585 T732A probably benign Het
Lmod3 T A 6: 97,247,301 T520S probably damaging Het
Megf8 G A 7: 25,343,720 V1356I possibly damaging Het
Mical3 C T 6: 121,040,517 probably null Het
Mug4-ps A T 6: 121,950,317 noncoding transcript Het
Myo1f T A 17: 33,601,070 I783N probably damaging Het
Nr6a1 A C 2: 38,729,497 I462S probably damaging Het
Olfr1056 A G 2: 86,356,358 V8A probably benign Het
Olfr330 C T 11: 58,529,264 A241T probably damaging Het
Pah C A 10: 87,583,561 Q449K probably benign Het
Pced1a A G 2: 130,421,919 V271A probably damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Psg21 A G 7: 18,652,345 Y239H probably damaging Het
Ptprt T C 2: 162,268,029 Y180C probably damaging Het
Raet1d T A 10: 22,370,950 I59N probably damaging Het
Rfx1 T C 8: 84,093,018 L653P probably damaging Het
Rnase2a A G 14: 51,255,674 V78A possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Serbp1 T C 6: 67,272,867 probably benign Het
Tlr1 A T 5: 64,925,286 H649Q probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc6 T A 9: 8,656,730 D719E probably benign Het
Ttc21b A T 2: 66,236,354 S318R probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Uhmk1 T C 1: 170,212,237 Q187R probably damaging Het
Ung C T 5: 114,131,377 A50V probably benign Het
Upk3bl C T 5: 136,059,820 Q103* probably null Het
Usp17le C A 7: 104,769,143 C264F probably damaging Het
Vmn2r105 T A 17: 20,228,496 N140Y probably damaging Het
Vmn2r84 C T 10: 130,386,245 C702Y probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp748 G A 13: 67,540,804 P779L possibly damaging Het
Other mutations in Msi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Msi1 APN 5 115435521 missense possibly damaging 0.95
IGL01390:Msi1 APN 5 115438721 missense possibly damaging 0.72
IGL01585:Msi1 APN 5 115430890 critical splice donor site probably null
IGL02232:Msi1 APN 5 115441447 critical splice donor site probably null
R0416:Msi1 UTSW 5 115430649 missense possibly damaging 0.56
R0828:Msi1 UTSW 5 115430894 splice site probably null
R2353:Msi1 UTSW 5 115436509 intron probably benign
R2517:Msi1 UTSW 5 115445458 missense probably damaging 1.00
R4646:Msi1 UTSW 5 115451455 critical splice acceptor site probably null
R4663:Msi1 UTSW 5 115450275 missense probably damaging 1.00
R4897:Msi1 UTSW 5 115435595 intron probably benign
R4963:Msi1 UTSW 5 115450885 missense probably damaging 1.00
R5461:Msi1 UTSW 5 115441391 missense possibly damaging 0.89
R6019:Msi1 UTSW 5 115451491 missense probably damaging 1.00
R6431:Msi1 UTSW 5 115450925 missense probably damaging 0.98
R6957:Msi1 UTSW 5 115445424 missense probably benign 0.04
R7105:Msi1 UTSW 5 115433870 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCCTTGTAAGGTTCCTTAGGG -3'
(R):5'- ACTTGGTCTGACCTCACCTG -3'

Sequencing Primer
(F):5'- CACTAGAGCCAGCCAGAGTGTG -3'
(R):5'- CCTGTGGGGTGATCTGACTGC -3'
Posted On2018-02-27