Incidental Mutation 'R6210:Msi1'
ID 503395
Institutional Source Beutler Lab
Gene Symbol Msi1
Ensembl Gene ENSMUSG00000054256
Gene Name musashi RNA-binding protein 1
Synonyms Msi1h, Musahi1, m-Msi-1, Msi1
MMRRC Submission 044344-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.347) question?
Stock # R6210 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 115567734-115593757 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 115573535 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 8 (I8T)
Ref Sequence ENSEMBL: ENSMUSP00000143900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000136586] [ENSMUST00000150779]
AlphaFold Q61474
Predicted Effect unknown
Transcript: ENSMUST00000067168
AA Change: I84T
SMART Domains Protein: ENSMUSP00000070415
Gene: ENSMUSG00000054256
AA Change: I84T

DomainStartEndE-ValueType
RRM 2 67 7.47e-14 SMART
RRM 84 156 4e-23 SMART
low complexity region 258 269 N/A INTRINSIC
low complexity region 297 304 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130849
Predicted Effect unknown
Transcript: ENSMUST00000131079
AA Change: I83T
Predicted Effect probably damaging
Transcript: ENSMUST00000136586
AA Change: I8T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143900
Gene: ENSMUSG00000054256
AA Change: I8T

DomainStartEndE-ValueType
RRM 7 79 1.7e-25 SMART
transmembrane domain 102 124 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145840
Predicted Effect possibly damaging
Transcript: ENSMUST00000150779
AA Change: I111T

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120516
Gene: ENSMUSG00000054256
AA Change: I111T

DomainStartEndE-ValueType
RRM 21 93 2e-23 SMART
RRM 110 182 4e-23 SMART
low complexity region 295 306 N/A INTRINSIC
low complexity region 334 341 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202548
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing two conserved tandem RNA recognition motifs. Similar proteins in other species function as RNA-binding proteins and play central roles in posttranscriptional gene regulation. Expression of this gene has been correlated with the grade of the malignancy and proliferative activity in gliomas and melanomas. A pseudogene for this gene is located on chromosome 11q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygous null mice develop hydrocephalus associated with progressive ventricular dilation, a large domed cranium, thin cerebral cortices, callosal agenesis, aberrant proliferation and polyposis of ependymal cells, intracerebral bleeding, ataxia, dehydration and death at 1-2 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T A 18: 10,706,032 (GRCm39) I94F probably damaging Het
Bbox1 A T 2: 110,100,422 (GRCm39) D258E probably benign Het
Catsperb A G 12: 101,378,827 (GRCm39) probably null Het
Ccdc127 T C 13: 74,505,040 (GRCm39) V196A probably benign Het
Cd101 A T 3: 100,925,959 (GRCm39) D253E probably damaging Het
Ceacam15 T C 7: 16,407,214 (GRCm39) Y101C probably damaging Het
Cep135 C T 5: 76,772,570 (GRCm39) L652F probably benign Het
Col5a1 G T 2: 27,922,633 (GRCm39) V234L probably benign Het
Cxcr6 T C 9: 123,639,073 (GRCm39) S25P possibly damaging Het
Dctn4 C T 18: 60,679,865 (GRCm39) Q258* probably null Het
Fmnl2 A T 2: 53,020,457 (GRCm39) N1067I possibly damaging Het
Frrs1 A T 3: 116,672,080 (GRCm39) K59N probably benign Het
Gpr157 T C 4: 150,186,055 (GRCm39) Y206H probably damaging Het
Hephl1 A G 9: 15,001,860 (GRCm39) Y161H possibly damaging Het
Hinfp C T 9: 44,210,169 (GRCm39) probably null Het
Igf2r A T 17: 12,933,838 (GRCm39) N805K probably damaging Het
Ilrun A T 17: 27,986,960 (GRCm39) D255E probably benign Het
Itga3 T C 11: 94,959,717 (GRCm39) probably benign Het
Itga6 A G 2: 71,664,351 (GRCm39) probably null Het
Kcnip1 G A 11: 33,595,600 (GRCm39) T30I possibly damaging Het
Lig4 T C 8: 10,021,585 (GRCm39) T732A probably benign Het
Lmod3 T A 6: 97,224,262 (GRCm39) T520S probably damaging Het
Megf8 G A 7: 25,043,145 (GRCm39) V1356I possibly damaging Het
Mical3 C T 6: 121,017,478 (GRCm39) probably null Het
Mug4-ps A T 6: 121,927,276 (GRCm39) noncoding transcript Het
Myo1f T A 17: 33,820,044 (GRCm39) I783N probably damaging Het
Nr6a1 A C 2: 38,619,509 (GRCm39) I462S probably damaging Het
Or2t48 C T 11: 58,420,090 (GRCm39) A241T probably damaging Het
Or8k23 A G 2: 86,186,702 (GRCm39) V8A probably benign Het
Pah C A 10: 87,419,423 (GRCm39) Q449K probably benign Het
Pced1a A G 2: 130,263,839 (GRCm39) V271A probably damaging Het
Pdzrn4 A T 15: 92,655,562 (GRCm39) E485V probably damaging Het
Psg21 A G 7: 18,386,270 (GRCm39) Y239H probably damaging Het
Ptprt T C 2: 162,109,949 (GRCm39) Y180C probably damaging Het
Raet1d T A 10: 22,246,849 (GRCm39) I59N probably damaging Het
Rfx1 T C 8: 84,819,647 (GRCm39) L653P probably damaging Het
Rnase2a A G 14: 51,493,131 (GRCm39) V78A possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Homo
Serbp1 T C 6: 67,249,851 (GRCm39) probably benign Het
Tlr1 A T 5: 65,082,629 (GRCm39) H649Q probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trpc6 T A 9: 8,656,731 (GRCm39) D719E probably benign Het
Ttc21b A T 2: 66,066,698 (GRCm39) S318R probably benign Het
Ttn G A 2: 76,579,673 (GRCm39) T23740M probably damaging Het
Uhmk1 T C 1: 170,039,806 (GRCm39) Q187R probably damaging Het
Ung C T 5: 114,269,438 (GRCm39) A50V probably benign Het
Upk3bl C T 5: 136,088,674 (GRCm39) Q103* probably null Het
Usp17le C A 7: 104,418,350 (GRCm39) C264F probably damaging Het
Vmn2r105 T A 17: 20,448,758 (GRCm39) N140Y probably damaging Het
Vmn2r84 C T 10: 130,222,114 (GRCm39) C702Y probably damaging Het
Zfp709 TCGACG TCG 8: 72,644,552 (GRCm39) probably benign Het
Zfp748 G A 13: 67,688,923 (GRCm39) P779L possibly damaging Het
Other mutations in Msi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Msi1 APN 5 115,573,580 (GRCm39) missense possibly damaging 0.95
IGL01390:Msi1 APN 5 115,576,780 (GRCm39) missense possibly damaging 0.72
IGL01585:Msi1 APN 5 115,568,949 (GRCm39) critical splice donor site probably null
IGL02232:Msi1 APN 5 115,579,506 (GRCm39) critical splice donor site probably null
R0416:Msi1 UTSW 5 115,568,708 (GRCm39) missense possibly damaging 0.56
R0828:Msi1 UTSW 5 115,568,953 (GRCm39) splice site probably null
R2353:Msi1 UTSW 5 115,574,568 (GRCm39) intron probably benign
R2517:Msi1 UTSW 5 115,583,517 (GRCm39) missense probably damaging 1.00
R4646:Msi1 UTSW 5 115,589,514 (GRCm39) critical splice acceptor site probably null
R4663:Msi1 UTSW 5 115,588,334 (GRCm39) missense probably damaging 1.00
R4897:Msi1 UTSW 5 115,573,654 (GRCm39) intron probably benign
R4963:Msi1 UTSW 5 115,588,944 (GRCm39) missense probably damaging 1.00
R5461:Msi1 UTSW 5 115,579,450 (GRCm39) missense possibly damaging 0.89
R6019:Msi1 UTSW 5 115,589,550 (GRCm39) missense probably damaging 1.00
R6431:Msi1 UTSW 5 115,588,984 (GRCm39) missense probably damaging 0.98
R6957:Msi1 UTSW 5 115,583,483 (GRCm39) missense probably benign 0.04
R7105:Msi1 UTSW 5 115,571,929 (GRCm39) missense probably damaging 1.00
R8984:Msi1 UTSW 5 115,573,598 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATCCTTGTAAGGTTCCTTAGGG -3'
(R):5'- ACTTGGTCTGACCTCACCTG -3'

Sequencing Primer
(F):5'- CACTAGAGCCAGCCAGAGTGTG -3'
(R):5'- CCTGTGGGGTGATCTGACTGC -3'
Posted On 2018-02-27