Incidental Mutation 'R6210:Lmod3'
ID503397
Institutional Source Beutler Lab
Gene Symbol Lmod3
Ensembl Gene ENSMUSG00000044086
Gene Nameleiomodin 3 (fetal)
Synonyms5430424A14Rik
MMRRC Submission 044344-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6210 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location97238534-97252759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97247301 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 520 (T520S)
Ref Sequence ENSEMBL: ENSMUSP00000093315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095655]
Predicted Effect probably damaging
Transcript: ENSMUST00000095655
AA Change: T520S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000093315
Gene: ENSMUSG00000044086
AA Change: T520S

DomainStartEndE-ValueType
Pfam:Tropomodulin 8 177 1.2e-13 PFAM
PDB:1IO0|A 248 406 9e-46 PDB
SCOP:d1a4ya_ 261 358 1e-3 SMART
low complexity region 407 427 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the leiomodin family of proteins. This protein contains three actin-binding domains, a tropomyosin domain, a leucine-rich repeat domain, and a Wiskott-Aldrich syndrome protein homology 2 domain (WH2). Localization of this protein to the pointed ends of thin filaments has been observed, and there is evidence that this protein acts as a catalyst of actin nucleation, and is important to the organization of sarcomeric thin filaments in skeletal muscles. Mutations in this gene have been associated as one cause of Nemaline myopathy, as other genes have also been linked to this disorder. Nemaline myopathy is a disorder characterized by nonprogressive generalized muscle weakness and protein inclusions (nemaline bodies) in skeletal myofibers. Patients with mutations in this gene often present with a severe congenital form of the disorder. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for an endonuclease-mediated mutation are runted and exhibit nemaline myopathy including a reduction in skeletal myofiber size, centrally nucleated skeletal muscle fibers, increase in skeletal muscle glycogen levels, and abnormal sarcomere and Z lines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T A 18: 10,706,032 I94F probably damaging Het
Bbox1 A T 2: 110,270,077 D258E probably benign Het
Catsperb A G 12: 101,412,568 probably null Het
Ccdc127 T C 13: 74,356,921 V196A probably benign Het
Cd101 A T 3: 101,018,643 D253E probably damaging Het
Ceacam15 T C 7: 16,673,289 Y101C probably damaging Het
Cep135 C T 5: 76,624,723 L652F probably benign Het
Col5a1 G T 2: 28,032,621 V234L probably benign Het
Cxcr6 T C 9: 123,810,008 S25P possibly damaging Het
D17Wsu92e A T 17: 27,767,986 D255E probably benign Het
Dctn4 C T 18: 60,546,793 Q258* probably null Het
Fmnl2 A T 2: 53,130,445 N1067I possibly damaging Het
Frrs1 A T 3: 116,878,431 K59N probably benign Het
Gpr157 T C 4: 150,101,598 Y206H probably damaging Het
Hephl1 A G 9: 15,090,564 Y161H possibly damaging Het
Hinfp C T 9: 44,298,872 probably null Het
Igf2r A T 17: 12,714,951 N805K probably damaging Het
Itga3 T C 11: 95,068,891 probably benign Het
Itga6 A G 2: 71,834,007 probably null Het
Kcnip1 G A 11: 33,645,600 T30I possibly damaging Het
Lig4 T C 8: 9,971,585 T732A probably benign Het
Megf8 G A 7: 25,343,720 V1356I possibly damaging Het
Mical3 C T 6: 121,040,517 probably null Het
Msi1 T C 5: 115,435,476 I8T probably damaging Het
Mug4-ps A T 6: 121,950,317 noncoding transcript Het
Myo1f T A 17: 33,601,070 I783N probably damaging Het
Nr6a1 A C 2: 38,729,497 I462S probably damaging Het
Olfr1056 A G 2: 86,356,358 V8A probably benign Het
Olfr330 C T 11: 58,529,264 A241T probably damaging Het
Pah C A 10: 87,583,561 Q449K probably benign Het
Pced1a A G 2: 130,421,919 V271A probably damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Psg21 A G 7: 18,652,345 Y239H probably damaging Het
Ptprt T C 2: 162,268,029 Y180C probably damaging Het
Raet1d T A 10: 22,370,950 I59N probably damaging Het
Rfx1 T C 8: 84,093,018 L653P probably damaging Het
Rnase2a A G 14: 51,255,674 V78A possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Serbp1 T C 6: 67,272,867 probably benign Het
Tlr1 A T 5: 64,925,286 H649Q probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc6 T A 9: 8,656,730 D719E probably benign Het
Ttc21b A T 2: 66,236,354 S318R probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Uhmk1 T C 1: 170,212,237 Q187R probably damaging Het
Ung C T 5: 114,131,377 A50V probably benign Het
Upk3bl C T 5: 136,059,820 Q103* probably null Het
Usp17le C A 7: 104,769,143 C264F probably damaging Het
Vmn2r105 T A 17: 20,228,496 N140Y probably damaging Het
Vmn2r84 C T 10: 130,386,245 C702Y probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp748 G A 13: 67,540,804 P779L possibly damaging Het
Other mutations in Lmod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Lmod3 APN 6 97252297 missense probably damaging 0.99
IGL00465:Lmod3 APN 6 97247861 missense probably damaging 1.00
IGL01401:Lmod3 APN 6 97252552 missense probably damaging 1.00
IGL02279:Lmod3 APN 6 97247672 missense probably damaging 1.00
IGL02621:Lmod3 APN 6 97238835 utr 3 prime probably benign
IGL03116:Lmod3 APN 6 97247195 missense possibly damaging 0.92
Runted UTSW 6 97247273 missense probably damaging 1.00
R0086:Lmod3 UTSW 6 97247345 missense probably damaging 1.00
R0627:Lmod3 UTSW 6 97248071 missense probably damaging 0.96
R2208:Lmod3 UTSW 6 97247877 missense probably benign 0.06
R4038:Lmod3 UTSW 6 97248314 missense probably benign 0.06
R4913:Lmod3 UTSW 6 97247164 splice site probably null
R5867:Lmod3 UTSW 6 97248002 missense probably damaging 1.00
R5905:Lmod3 UTSW 6 97247614 missense probably damaging 1.00
R6035:Lmod3 UTSW 6 97247273 missense probably damaging 1.00
R6035:Lmod3 UTSW 6 97247273 missense probably damaging 1.00
R6183:Lmod3 UTSW 6 97252553 missense probably damaging 1.00
R6527:Lmod3 UTSW 6 97247378 missense probably benign 0.00
R7225:Lmod3 UTSW 6 97247384 missense probably benign 0.34
R7531:Lmod3 UTSW 6 97248442 missense probably benign 0.01
R7908:Lmod3 UTSW 6 97248473 missense probably benign 0.05
R8022:Lmod3 UTSW 6 97248299 missense probably benign
R8154:Lmod3 UTSW 6 97247980 missense probably damaging 1.00
R8325:Lmod3 UTSW 6 97247418 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGGGAAGCGTTCGTCTTTTCTC -3'
(R):5'- GCAGCAGCAACTTAAAGAGC -3'

Sequencing Primer
(F):5'- AAGCGTTCGTCTTTTCTCCCTCC -3'
(R):5'- CCCAGAATGCAGGAGTTCTTC -3'
Posted On2018-02-27