Incidental Mutation 'R6210:Psg21'
ID 503401
Institutional Source Beutler Lab
Gene Symbol Psg21
Ensembl Gene ENSMUSG00000070796
Gene Name pregnancy-specific beta-1-glycoprotein 21
Synonyms 1600019C01Rik, 1600026N13Rik, 1600025N01Rik, cea8
MMRRC Submission 044344-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R6210 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 18380661-18390650 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18386270 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 239 (Y239H)
Ref Sequence ENSEMBL: ENSMUSP00000138173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094793] [ENSMUST00000182128]
AlphaFold Q9DAV5
Predicted Effect probably damaging
Transcript: ENSMUST00000094793
AA Change: Y239H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092387
Gene: ENSMUSG00000070796
AA Change: Y239H

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
IGc2 393 457 1.47e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182128
AA Change: Y239H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138173
Gene: ENSMUSG00000070796
AA Change: Y239H

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182933
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T A 18: 10,706,032 (GRCm39) I94F probably damaging Het
Bbox1 A T 2: 110,100,422 (GRCm39) D258E probably benign Het
Catsperb A G 12: 101,378,827 (GRCm39) probably null Het
Ccdc127 T C 13: 74,505,040 (GRCm39) V196A probably benign Het
Cd101 A T 3: 100,925,959 (GRCm39) D253E probably damaging Het
Ceacam15 T C 7: 16,407,214 (GRCm39) Y101C probably damaging Het
Cep135 C T 5: 76,772,570 (GRCm39) L652F probably benign Het
Col5a1 G T 2: 27,922,633 (GRCm39) V234L probably benign Het
Cxcr6 T C 9: 123,639,073 (GRCm39) S25P possibly damaging Het
Dctn4 C T 18: 60,679,865 (GRCm39) Q258* probably null Het
Fmnl2 A T 2: 53,020,457 (GRCm39) N1067I possibly damaging Het
Frrs1 A T 3: 116,672,080 (GRCm39) K59N probably benign Het
Gpr157 T C 4: 150,186,055 (GRCm39) Y206H probably damaging Het
Hephl1 A G 9: 15,001,860 (GRCm39) Y161H possibly damaging Het
Hinfp C T 9: 44,210,169 (GRCm39) probably null Het
Igf2r A T 17: 12,933,838 (GRCm39) N805K probably damaging Het
Ilrun A T 17: 27,986,960 (GRCm39) D255E probably benign Het
Itga3 T C 11: 94,959,717 (GRCm39) probably benign Het
Itga6 A G 2: 71,664,351 (GRCm39) probably null Het
Kcnip1 G A 11: 33,595,600 (GRCm39) T30I possibly damaging Het
Lig4 T C 8: 10,021,585 (GRCm39) T732A probably benign Het
Lmod3 T A 6: 97,224,262 (GRCm39) T520S probably damaging Het
Megf8 G A 7: 25,043,145 (GRCm39) V1356I possibly damaging Het
Mical3 C T 6: 121,017,478 (GRCm39) probably null Het
Msi1 T C 5: 115,573,535 (GRCm39) I8T probably damaging Het
Mug4-ps A T 6: 121,927,276 (GRCm39) noncoding transcript Het
Myo1f T A 17: 33,820,044 (GRCm39) I783N probably damaging Het
Nr6a1 A C 2: 38,619,509 (GRCm39) I462S probably damaging Het
Or2t48 C T 11: 58,420,090 (GRCm39) A241T probably damaging Het
Or8k23 A G 2: 86,186,702 (GRCm39) V8A probably benign Het
Pah C A 10: 87,419,423 (GRCm39) Q449K probably benign Het
Pced1a A G 2: 130,263,839 (GRCm39) V271A probably damaging Het
Pdzrn4 A T 15: 92,655,562 (GRCm39) E485V probably damaging Het
Ptprt T C 2: 162,109,949 (GRCm39) Y180C probably damaging Het
Raet1d T A 10: 22,246,849 (GRCm39) I59N probably damaging Het
Rfx1 T C 8: 84,819,647 (GRCm39) L653P probably damaging Het
Rnase2a A G 14: 51,493,131 (GRCm39) V78A possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Homo
Serbp1 T C 6: 67,249,851 (GRCm39) probably benign Het
Tlr1 A T 5: 65,082,629 (GRCm39) H649Q probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trpc6 T A 9: 8,656,731 (GRCm39) D719E probably benign Het
Ttc21b A T 2: 66,066,698 (GRCm39) S318R probably benign Het
Ttn G A 2: 76,579,673 (GRCm39) T23740M probably damaging Het
Uhmk1 T C 1: 170,039,806 (GRCm39) Q187R probably damaging Het
Ung C T 5: 114,269,438 (GRCm39) A50V probably benign Het
Upk3bl C T 5: 136,088,674 (GRCm39) Q103* probably null Het
Usp17le C A 7: 104,418,350 (GRCm39) C264F probably damaging Het
Vmn2r105 T A 17: 20,448,758 (GRCm39) N140Y probably damaging Het
Vmn2r84 C T 10: 130,222,114 (GRCm39) C702Y probably damaging Het
Zfp709 TCGACG TCG 8: 72,644,552 (GRCm39) probably benign Het
Zfp748 G A 13: 67,688,923 (GRCm39) P779L possibly damaging Het
Other mutations in Psg21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Psg21 APN 7 18,388,750 (GRCm39) missense probably damaging 1.00
IGL02390:Psg21 APN 7 18,386,556 (GRCm39) missense probably benign 0.11
IGL02548:Psg21 APN 7 18,388,961 (GRCm39) missense possibly damaging 0.89
IGL03001:Psg21 APN 7 18,386,410 (GRCm39) missense probably benign 0.03
IGL03135:Psg21 APN 7 18,388,843 (GRCm39) missense probably benign 0.00
R0131:Psg21 UTSW 7 18,388,793 (GRCm39) missense probably benign 0.39
R0551:Psg21 UTSW 7 18,386,565 (GRCm39) critical splice acceptor site probably null
R1512:Psg21 UTSW 7 18,390,425 (GRCm39) missense probably benign 0.00
R1874:Psg21 UTSW 7 18,384,741 (GRCm39) missense probably benign 0.15
R1993:Psg21 UTSW 7 18,388,695 (GRCm39) missense probably benign 0.04
R2327:Psg21 UTSW 7 18,386,378 (GRCm39) missense possibly damaging 0.61
R3414:Psg21 UTSW 7 18,386,305 (GRCm39) missense probably damaging 1.00
R4422:Psg21 UTSW 7 18,381,257 (GRCm39) missense probably damaging 1.00
R5138:Psg21 UTSW 7 18,390,453 (GRCm39) start codon destroyed probably null 0.94
R5623:Psg21 UTSW 7 18,388,939 (GRCm39) missense probably damaging 1.00
R5686:Psg21 UTSW 7 18,386,183 (GRCm39) intron probably benign
R6166:Psg21 UTSW 7 18,390,664 (GRCm39) unclassified probably benign
R6177:Psg21 UTSW 7 18,386,279 (GRCm39) missense possibly damaging 0.64
R6190:Psg21 UTSW 7 18,388,926 (GRCm39) missense possibly damaging 0.61
R6482:Psg21 UTSW 7 18,388,664 (GRCm39) splice site probably null
R6729:Psg21 UTSW 7 18,386,516 (GRCm39) missense probably damaging 1.00
R6866:Psg21 UTSW 7 18,386,209 (GRCm39) missense probably damaging 1.00
R6992:Psg21 UTSW 7 18,388,668 (GRCm39) critical splice donor site probably null
R7075:Psg21 UTSW 7 18,388,786 (GRCm39) missense probably damaging 1.00
R7081:Psg21 UTSW 7 18,388,774 (GRCm39) nonsense probably null
R7098:Psg21 UTSW 7 18,386,470 (GRCm39) missense probably damaging 1.00
R7582:Psg21 UTSW 7 18,381,128 (GRCm39) makesense probably null
R7588:Psg21 UTSW 7 18,381,134 (GRCm39) missense probably benign 0.00
R7607:Psg21 UTSW 7 18,388,708 (GRCm39) missense probably benign 0.02
R7830:Psg21 UTSW 7 18,381,223 (GRCm39) missense probably damaging 1.00
R7964:Psg21 UTSW 7 18,381,136 (GRCm39) missense probably benign 0.01
R8758:Psg21 UTSW 7 18,384,678 (GRCm39) missense probably damaging 1.00
R8972:Psg21 UTSW 7 18,381,293 (GRCm39) missense probably benign 0.03
R8988:Psg21 UTSW 7 18,386,389 (GRCm39) missense probably benign 0.00
R9119:Psg21 UTSW 7 18,381,409 (GRCm39) missense probably benign 0.14
R9446:Psg21 UTSW 7 18,388,865 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGTGACCTGTACACAGTGG -3'
(R):5'- TCCGTGTTCACAATCTTCCAGAG -3'

Sequencing Primer
(F):5'- GTGACCTGTACACAGTGGTCAAAC -3'
(R):5'- GTTCACAATCTTCCAGAGTATCTTC -3'
Posted On 2018-02-27