Incidental Mutation 'R6210:Zfp709'
ID503406
Institutional Source Beutler Lab
Gene Symbol Zfp709
Ensembl Gene ENSMUSG00000056019
Gene Namezinc finger protein 709
SynonymsGIOT-4
MMRRC Submission 044344-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6210 (G1)
Quality Score217.468
Status Validated
Chromosome8
Chromosomal Location71882019-71895727 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) TCGACG to TCG at 71890708 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034259] [ENSMUST00000188374] [ENSMUST00000188685]
Predicted Effect probably benign
Transcript: ENSMUST00000034259
SMART Domains Protein: ENSMUSP00000034259
Gene: ENSMUSG00000056019

DomainStartEndE-ValueType
KRAB 3 68 3.08e-15 SMART
ZnF_C2H2 224 246 6.78e-3 SMART
ZnF_C2H2 252 274 2.09e-3 SMART
ZnF_C2H2 280 302 2.05e-2 SMART
ZnF_C2H2 308 330 2.4e-3 SMART
ZnF_C2H2 336 358 1.36e-2 SMART
ZnF_C2H2 364 386 1.36e-2 SMART
ZnF_C2H2 392 414 1.69e-3 SMART
ZnF_C2H2 420 442 5.14e-3 SMART
ZnF_C2H2 448 470 1.67e-2 SMART
ZnF_C2H2 476 498 1.1e-2 SMART
ZnF_C2H2 504 526 2.86e-1 SMART
ZnF_C2H2 532 554 7.26e-3 SMART
ZnF_C2H2 560 582 8.34e-3 SMART
ZnF_C2H2 588 610 1.5e-4 SMART
ZnF_C2H2 616 638 1.18e-2 SMART
ZnF_C2H2 644 666 1.06e-4 SMART
ZnF_C2H2 672 694 1.18e-2 SMART
ZnF_C2H2 700 722 8.94e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188374
SMART Domains Protein: ENSMUSP00000141000
Gene: ENSMUSG00000056019

DomainStartEndE-ValueType
KRAB 4 56 9.2e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188685
SMART Domains Protein: ENSMUSP00000140285
Gene: ENSMUSG00000056019

DomainStartEndE-ValueType
KRAB 4 69 3.08e-15 SMART
ZnF_C2H2 225 247 6.78e-3 SMART
ZnF_C2H2 253 275 2.09e-3 SMART
ZnF_C2H2 281 303 2.05e-2 SMART
ZnF_C2H2 309 331 2.4e-3 SMART
ZnF_C2H2 337 359 1.36e-2 SMART
ZnF_C2H2 365 387 1.36e-2 SMART
ZnF_C2H2 393 415 1.69e-3 SMART
ZnF_C2H2 421 443 5.14e-3 SMART
ZnF_C2H2 449 471 1.67e-2 SMART
ZnF_C2H2 477 499 1.1e-2 SMART
ZnF_C2H2 505 527 2.86e-1 SMART
ZnF_C2H2 533 555 7.26e-3 SMART
ZnF_C2H2 561 583 8.34e-3 SMART
ZnF_C2H2 589 611 1.5e-4 SMART
ZnF_C2H2 617 639 1.18e-2 SMART
ZnF_C2H2 645 667 1.06e-4 SMART
ZnF_C2H2 673 695 1.18e-2 SMART
ZnF_C2H2 701 723 8.94e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203585
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc finger proteins (ZNFs) bind DNA and, through this binding, regulate gene transcription. Most ZNFs contain conserved C2H2 motifs and are classified as Kruppel-type zinc fingers. For a general description of these proteins, see ZNF91 (MIM 603971).[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T A 18: 10,706,032 I94F probably damaging Het
Bbox1 A T 2: 110,270,077 D258E probably benign Het
Catsperb A G 12: 101,412,568 probably null Het
Ccdc127 T C 13: 74,356,921 V196A probably benign Het
Cd101 A T 3: 101,018,643 D253E probably damaging Het
Ceacam15 T C 7: 16,673,289 Y101C probably damaging Het
Cep135 C T 5: 76,624,723 L652F probably benign Het
Col5a1 G T 2: 28,032,621 V234L probably benign Het
Cxcr6 T C 9: 123,810,008 S25P possibly damaging Het
D17Wsu92e A T 17: 27,767,986 D255E probably benign Het
Dctn4 C T 18: 60,546,793 Q258* probably null Het
Fmnl2 A T 2: 53,130,445 N1067I possibly damaging Het
Frrs1 A T 3: 116,878,431 K59N probably benign Het
Gpr157 T C 4: 150,101,598 Y206H probably damaging Het
Hephl1 A G 9: 15,090,564 Y161H possibly damaging Het
Hinfp C T 9: 44,298,872 probably null Het
Igf2r A T 17: 12,714,951 N805K probably damaging Het
Itga3 T C 11: 95,068,891 probably benign Het
Itga6 A G 2: 71,834,007 probably null Het
Kcnip1 G A 11: 33,645,600 T30I possibly damaging Het
Lig4 T C 8: 9,971,585 T732A probably benign Het
Lmod3 T A 6: 97,247,301 T520S probably damaging Het
Megf8 G A 7: 25,343,720 V1356I possibly damaging Het
Mical3 C T 6: 121,040,517 probably null Het
Msi1 T C 5: 115,435,476 I8T probably damaging Het
Mug4-ps A T 6: 121,950,317 noncoding transcript Het
Myo1f T A 17: 33,601,070 I783N probably damaging Het
Nr6a1 A C 2: 38,729,497 I462S probably damaging Het
Olfr1056 A G 2: 86,356,358 V8A probably benign Het
Olfr330 C T 11: 58,529,264 A241T probably damaging Het
Pah C A 10: 87,583,561 Q449K probably benign Het
Pced1a A G 2: 130,421,919 V271A probably damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Psg21 A G 7: 18,652,345 Y239H probably damaging Het
Ptprt T C 2: 162,268,029 Y180C probably damaging Het
Raet1d T A 10: 22,370,950 I59N probably damaging Het
Rfx1 T C 8: 84,093,018 L653P probably damaging Het
Rnase2a A G 14: 51,255,674 V78A possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Serbp1 T C 6: 67,272,867 probably benign Het
Tlr1 A T 5: 64,925,286 H649Q probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc6 T A 9: 8,656,730 D719E probably benign Het
Ttc21b A T 2: 66,236,354 S318R probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Uhmk1 T C 1: 170,212,237 Q187R probably damaging Het
Ung C T 5: 114,131,377 A50V probably benign Het
Upk3bl C T 5: 136,059,820 Q103* probably null Het
Usp17le C A 7: 104,769,143 C264F probably damaging Het
Vmn2r105 T A 17: 20,228,496 N140Y probably damaging Het
Vmn2r84 C T 10: 130,386,245 C702Y probably damaging Het
Zfp748 G A 13: 67,540,804 P779L possibly damaging Het
Other mutations in Zfp709
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03174:Zfp709 APN 8 71889026 missense probably benign 0.03
IGL03187:Zfp709 APN 8 71889282 missense probably benign 0.41
BB007:Zfp709 UTSW 8 71890840 missense probably damaging 0.97
BB017:Zfp709 UTSW 8 71890840 missense probably damaging 0.97
R0336:Zfp709 UTSW 8 71890605 missense probably damaging 1.00
R1386:Zfp709 UTSW 8 71890662 missense probably damaging 0.99
R1878:Zfp709 UTSW 8 71890047 missense probably damaging 1.00
R2279:Zfp709 UTSW 8 71889090 missense probably benign 0.31
R2320:Zfp709 UTSW 8 71887292 missense probably damaging 1.00
R2885:Zfp709 UTSW 8 71889705 missense probably benign 0.08
R3833:Zfp709 UTSW 8 71889062 missense probably benign 0.00
R3926:Zfp709 UTSW 8 71890553 missense probably damaging 1.00
R4165:Zfp709 UTSW 8 71890805 nonsense probably null
R4179:Zfp709 UTSW 8 71889906 missense probably damaging 1.00
R4963:Zfp709 UTSW 8 71889788 missense probably benign 0.27
R5340:Zfp709 UTSW 8 71889752 missense probably damaging 1.00
R5427:Zfp709 UTSW 8 71889132 missense probably benign 0.27
R5513:Zfp709 UTSW 8 71890056 missense probably damaging 1.00
R5639:Zfp709 UTSW 8 71889991 splice site probably null
R5692:Zfp709 UTSW 8 71890155 missense probably damaging 1.00
R5872:Zfp709 UTSW 8 71889519 missense probably benign 0.03
R5940:Zfp709 UTSW 8 71890220 missense possibly damaging 0.85
R6192:Zfp709 UTSW 8 71890708 small deletion probably benign
R6225:Zfp709 UTSW 8 71890708 small deletion probably benign
R6227:Zfp709 UTSW 8 71890708 small deletion probably benign
R6228:Zfp709 UTSW 8 71890708 small deletion probably benign
R6246:Zfp709 UTSW 8 71890708 small deletion probably benign
R6247:Zfp709 UTSW 8 71890708 small deletion probably benign
R6248:Zfp709 UTSW 8 71890708 small deletion probably benign
R6249:Zfp709 UTSW 8 71890708 small deletion probably benign
R6250:Zfp709 UTSW 8 71890708 small deletion probably benign
R6258:Zfp709 UTSW 8 71890708 small deletion probably benign
R6259:Zfp709 UTSW 8 71890708 small deletion probably benign
R6371:Zfp709 UTSW 8 71889485 missense probably damaging 1.00
R6875:Zfp709 UTSW 8 71889007 missense possibly damaging 0.93
R7871:Zfp709 UTSW 8 71889464 missense probably benign 0.02
R7930:Zfp709 UTSW 8 71890840 missense probably damaging 0.97
R7943:Zfp709 UTSW 8 71890089 missense probably damaging 1.00
R8202:Zfp709 UTSW 8 71888916 splice site probably null
R8555:Zfp709 UTSW 8 71889632 missense probably benign 0.04
R8735:Zfp709 UTSW 8 71889183 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTCTTCTTTGAGTGGTTGTCAA -3'
(R):5'- CCTTTCCATGTTCTATACTTAGGGA -3'

Sequencing Primer
(F):5'- GGGAAAGCCTTTACTAATCCCAGTG -3'
(R):5'- ATACTTAGGGACTTCTACTGTGAGTC -3'
Posted On2018-02-27