Incidental Mutation 'R6210:Raet1d'
ID503412
Institutional Source Beutler Lab
Gene Symbol Raet1d
Ensembl Gene ENSMUSG00000078452
Gene Nameretinoic acid early transcript delta
SynonymsRAE-1delta
MMRRC Submission 044344-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6210 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location22360552-22374139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22370950 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 59 (I59N)
Ref Sequence ENSEMBL: ENSMUSP00000138328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095795] [ENSMUST00000178026] [ENSMUST00000182677]
Predicted Effect probably damaging
Transcript: ENSMUST00000095795
AA Change: I59N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000093471
Gene: ENSMUSG00000078452
AA Change: I59N

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:MHC_I_2 31 200 2.6e-110 PFAM
low complexity region 207 227 N/A INTRINSIC
transmembrane domain 231 248 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178026
SMART Domains Protein: ENSMUSP00000136032
Gene: ENSMUSG00000053219

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:MHC_I_2 31 202 7.3e-112 PFAM
low complexity region 209 229 N/A INTRINSIC
transmembrane domain 233 250 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182677
AA Change: I59N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138328
Gene: ENSMUSG00000078452
AA Change: I59N

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:MHC_I_2 31 200 5.4e-119 PFAM
low complexity region 207 227 N/A INTRINSIC
transmembrane domain 231 248 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T A 18: 10,706,032 I94F probably damaging Het
Bbox1 A T 2: 110,270,077 D258E probably benign Het
Catsperb A G 12: 101,412,568 probably null Het
Ccdc127 T C 13: 74,356,921 V196A probably benign Het
Cd101 A T 3: 101,018,643 D253E probably damaging Het
Ceacam15 T C 7: 16,673,289 Y101C probably damaging Het
Cep135 C T 5: 76,624,723 L652F probably benign Het
Col5a1 G T 2: 28,032,621 V234L probably benign Het
Cxcr6 T C 9: 123,810,008 S25P possibly damaging Het
D17Wsu92e A T 17: 27,767,986 D255E probably benign Het
Dctn4 C T 18: 60,546,793 Q258* probably null Het
Fmnl2 A T 2: 53,130,445 N1067I possibly damaging Het
Frrs1 A T 3: 116,878,431 K59N probably benign Het
Gpr157 T C 4: 150,101,598 Y206H probably damaging Het
Hephl1 A G 9: 15,090,564 Y161H possibly damaging Het
Hinfp C T 9: 44,298,872 probably null Het
Igf2r A T 17: 12,714,951 N805K probably damaging Het
Itga3 T C 11: 95,068,891 probably benign Het
Itga6 A G 2: 71,834,007 probably null Het
Kcnip1 G A 11: 33,645,600 T30I possibly damaging Het
Lig4 T C 8: 9,971,585 T732A probably benign Het
Lmod3 T A 6: 97,247,301 T520S probably damaging Het
Megf8 G A 7: 25,343,720 V1356I possibly damaging Het
Mical3 C T 6: 121,040,517 probably null Het
Msi1 T C 5: 115,435,476 I8T probably damaging Het
Mug4-ps A T 6: 121,950,317 noncoding transcript Het
Myo1f T A 17: 33,601,070 I783N probably damaging Het
Nr6a1 A C 2: 38,729,497 I462S probably damaging Het
Olfr1056 A G 2: 86,356,358 V8A probably benign Het
Olfr330 C T 11: 58,529,264 A241T probably damaging Het
Pah C A 10: 87,583,561 Q449K probably benign Het
Pced1a A G 2: 130,421,919 V271A probably damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Psg21 A G 7: 18,652,345 Y239H probably damaging Het
Ptprt T C 2: 162,268,029 Y180C probably damaging Het
Rfx1 T C 8: 84,093,018 L653P probably damaging Het
Rnase2a A G 14: 51,255,674 V78A possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Serbp1 T C 6: 67,272,867 probably benign Het
Tlr1 A T 5: 64,925,286 H649Q probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc6 T A 9: 8,656,730 D719E probably benign Het
Ttc21b A T 2: 66,236,354 S318R probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Uhmk1 T C 1: 170,212,237 Q187R probably damaging Het
Ung C T 5: 114,131,377 A50V probably benign Het
Upk3bl C T 5: 136,059,820 Q103* probably null Het
Usp17le C A 7: 104,769,143 C264F probably damaging Het
Vmn2r105 T A 17: 20,228,496 N140Y probably damaging Het
Vmn2r84 C T 10: 130,386,245 C702Y probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp748 G A 13: 67,540,804 P779L possibly damaging Het
Other mutations in Raet1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Raet1d APN 10 22370892 missense possibly damaging 0.82
IGL02011:Raet1d APN 10 22371574 missense probably damaging 1.00
FR4340:Raet1d UTSW 10 22371559 missense probably benign
FR4342:Raet1d UTSW 10 22371559 missense probably benign
FR4449:Raet1d UTSW 10 22370915 small insertion probably benign
FR4589:Raet1d UTSW 10 22370918 nonsense probably null
PIT4434001:Raet1d UTSW 10 22371534 nonsense probably null
R0241:Raet1d UTSW 10 22371429 missense probably benign 0.21
R0241:Raet1d UTSW 10 22371429 missense probably benign 0.21
R0280:Raet1d UTSW 10 22370883 missense probably damaging 1.00
R0790:Raet1d UTSW 10 22370896 missense probably damaging 1.00
R1671:Raet1d UTSW 10 22362715 start codon destroyed probably null 0.18
R1901:Raet1d UTSW 10 22371451 missense probably damaging 0.96
R2018:Raet1d UTSW 10 22371012 missense probably damaging 1.00
R6004:Raet1d UTSW 10 22371394 missense probably damaging 1.00
R7661:Raet1d UTSW 10 22372257 missense possibly damaging 0.73
R8385:Raet1d UTSW 10 22370918 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACCCTGCAGAAGAATACTTGG -3'
(R):5'- ACATTCCTGCACGTACTCTG -3'

Sequencing Primer
(F):5'- CCTGCAGAAGAATACTTGGGATCAC -3'
(R):5'- TGTACTCTATCCATACTTACCATTGG -3'
Posted On2018-02-27