Incidental Mutation 'R6210:Pah'
ID503413
Institutional Source Beutler Lab
Gene Symbol Pah
Ensembl Gene ENSMUSG00000020051
Gene Namephenylalanine hydroxylase
SynonymsAW106920, OTTMUSP00000027786, PH, PKU, PKU1
MMRRC Submission 044344-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6210 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location87521795-87584136 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 87583561 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 449 (Q449K)
Ref Sequence ENSEMBL: ENSMUSP00000020241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020241] [ENSMUST00000219813]
Predicted Effect probably benign
Transcript: ENSMUST00000020241
AA Change: Q449K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000020241
Gene: ENSMUSG00000020051
AA Change: Q449K

DomainStartEndE-ValueType
Pfam:ACT 35 100 1.8e-10 PFAM
Pfam:Biopterin_H 119 449 1.3e-177 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000218573
AA Change: Q112K
Predicted Effect unknown
Transcript: ENSMUST00000219813
AA Change: Q77K
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PAH encodes the enzyme phenylalanine hydroxylase that is the rate-limiting step in phenylalanine catabolism. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for ENU-induced mutations of this gene have altered serum and urine phenylalanine levels and may display reduced body size, microcephaly, microphthalmia, decreased litter size, hypopigmentation, impaired balance/swimming, cognitive deficits, and environmentally-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T A 18: 10,706,032 I94F probably damaging Het
Bbox1 A T 2: 110,270,077 D258E probably benign Het
Catsperb A G 12: 101,412,568 probably null Het
Ccdc127 T C 13: 74,356,921 V196A probably benign Het
Cd101 A T 3: 101,018,643 D253E probably damaging Het
Ceacam15 T C 7: 16,673,289 Y101C probably damaging Het
Cep135 C T 5: 76,624,723 L652F probably benign Het
Col5a1 G T 2: 28,032,621 V234L probably benign Het
Cxcr6 T C 9: 123,810,008 S25P possibly damaging Het
D17Wsu92e A T 17: 27,767,986 D255E probably benign Het
Dctn4 C T 18: 60,546,793 Q258* probably null Het
Fmnl2 A T 2: 53,130,445 N1067I possibly damaging Het
Frrs1 A T 3: 116,878,431 K59N probably benign Het
Gpr157 T C 4: 150,101,598 Y206H probably damaging Het
Hephl1 A G 9: 15,090,564 Y161H possibly damaging Het
Hinfp C T 9: 44,298,872 probably null Het
Igf2r A T 17: 12,714,951 N805K probably damaging Het
Itga3 T C 11: 95,068,891 probably benign Het
Itga6 A G 2: 71,834,007 probably null Het
Kcnip1 G A 11: 33,645,600 T30I possibly damaging Het
Lig4 T C 8: 9,971,585 T732A probably benign Het
Lmod3 T A 6: 97,247,301 T520S probably damaging Het
Megf8 G A 7: 25,343,720 V1356I possibly damaging Het
Mical3 C T 6: 121,040,517 probably null Het
Msi1 T C 5: 115,435,476 I8T probably damaging Het
Mug4-ps A T 6: 121,950,317 noncoding transcript Het
Myo1f T A 17: 33,601,070 I783N probably damaging Het
Nr6a1 A C 2: 38,729,497 I462S probably damaging Het
Olfr1056 A G 2: 86,356,358 V8A probably benign Het
Olfr330 C T 11: 58,529,264 A241T probably damaging Het
Pced1a A G 2: 130,421,919 V271A probably damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Psg21 A G 7: 18,652,345 Y239H probably damaging Het
Ptprt T C 2: 162,268,029 Y180C probably damaging Het
Raet1d T A 10: 22,370,950 I59N probably damaging Het
Rfx1 T C 8: 84,093,018 L653P probably damaging Het
Rnase2a A G 14: 51,255,674 V78A possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Serbp1 T C 6: 67,272,867 probably benign Het
Tlr1 A T 5: 64,925,286 H649Q probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc6 T A 9: 8,656,730 D719E probably benign Het
Ttc21b A T 2: 66,236,354 S318R probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Uhmk1 T C 1: 170,212,237 Q187R probably damaging Het
Ung C T 5: 114,131,377 A50V probably benign Het
Upk3bl C T 5: 136,059,820 Q103* probably null Het
Usp17le C A 7: 104,769,143 C264F probably damaging Het
Vmn2r105 T A 17: 20,228,496 N140Y probably damaging Het
Vmn2r84 C T 10: 130,386,245 C702Y probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp748 G A 13: 67,540,804 P779L possibly damaging Het
Other mutations in Pah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Pah APN 10 87578893 missense probably benign 0.02
IGL00823:Pah APN 10 87570331 missense probably null 1.00
IGL01350:Pah APN 10 87578359 intron probably benign
IGL01668:Pah APN 10 87578261 missense probably damaging 1.00
IGL01794:Pah APN 10 87578922 missense possibly damaging 0.63
IGL01956:Pah APN 10 87538199 missense probably benign 0.03
IGL01985:Pah APN 10 87578982 missense probably damaging 1.00
IGL02014:Pah APN 10 87581927 missense probably benign 0.00
IGL02552:Pah APN 10 87578845 intron probably benign
IGL03096:Pah APN 10 87538242 critical splice donor site probably null
bronze UTSW 10 87570226 missense probably damaging 1.00
parakeet UTSW 10 87576215 critical splice donor site probably null
skeet UTSW 10 87538219 nonsense probably null
R0238:Pah UTSW 10 87567281 missense possibly damaging 0.74
R0239:Pah UTSW 10 87567281 missense possibly damaging 0.74
R0239:Pah UTSW 10 87567281 missense possibly damaging 0.74
R0839:Pah UTSW 10 87522062 missense probably damaging 1.00
R0853:Pah UTSW 10 87576218 splice site probably null
R1474:Pah UTSW 10 87578313 missense probably damaging 1.00
R1762:Pah UTSW 10 87567468 missense possibly damaging 0.91
R1886:Pah UTSW 10 87528328 missense possibly damaging 0.91
R2179:Pah UTSW 10 87567335 missense probably damaging 1.00
R2852:Pah UTSW 10 87567465 missense probably damaging 1.00
R3818:Pah UTSW 10 87522004 start gained probably benign
R4509:Pah UTSW 10 87576215 critical splice donor site probably null
R4725:Pah UTSW 10 87554376 missense probably damaging 1.00
R4911:Pah UTSW 10 87570267 missense probably benign 0.42
R5094:Pah UTSW 10 87538219 nonsense probably null
R5766:Pah UTSW 10 87567347 missense probably damaging 1.00
R6273:Pah UTSW 10 87576215 critical splice donor site probably null
R6345:Pah UTSW 10 87576187 missense probably damaging 1.00
R6349:Pah UTSW 10 87578969 missense probably benign 0.01
R7109:Pah UTSW 10 87570286 missense probably damaging 1.00
R7470:Pah UTSW 10 87563424 missense probably damaging 1.00
R7511:Pah UTSW 10 87554387 missense probably damaging 1.00
R8288:Pah UTSW 10 87538185 missense probably benign 0.00
R8447:Pah UTSW 10 87581965 critical splice donor site probably null
R8684:Pah UTSW 10 87578965 missense probably benign
Z1088:Pah UTSW 10 87571291 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACACACAGCAGAACAGGG -3'
(R):5'- TGACTCTGAAGGATCTACCACTG -3'

Sequencing Primer
(F):5'- CAGAACAGGGCTAGTATAGTCTTC -3'
(R):5'- AATTGATTTATTTGGTGATCCTCCAC -3'
Posted On2018-02-27