Incidental Mutation 'R6210:Kcnip1'
ID503415
Institutional Source Beutler Lab
Gene Symbol Kcnip1
Ensembl Gene ENSMUSG00000053519
Gene NameKv channel-interacting protein 1
Synonyms3202002F18Rik, 2900046L02Rik, KCHIP1
MMRRC Submission 044344-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R6210 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location33629339-33993152 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33645600 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 30 (T30I)
Ref Sequence ENSEMBL: ENSMUSP00000069063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065970] [ENSMUST00000101368] [ENSMUST00000109340]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065970
AA Change: T30I

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069063
Gene: ENSMUSG00000053519
AA Change: T30I

DomainStartEndE-ValueType
EFh 90 118 2.24e1 SMART
EFh 126 154 8.77e-7 SMART
EFh 174 202 2.83e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000101368
AA Change: T2I

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098919
Gene: ENSMUSG00000053519
AA Change: T2I

DomainStartEndE-ValueType
EFh 62 90 2.24e1 SMART
EFh 98 126 8.77e-7 SMART
EFh 146 174 2.83e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109340
AA Change: T41I

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104964
Gene: ENSMUSG00000053519
AA Change: T41I

DomainStartEndE-ValueType
EFh 101 129 2.24e1 SMART
EFh 137 165 8.77e-7 SMART
EFh 185 213 2.83e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154760
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of cytosolic voltage-gated potassium (Kv) channel-interacting proteins (KCNIPs), which belong to the neuronal calcium sensor (NCS) family of the calcium binding EF-hand proteins. They associate with Kv4 alpha subunits to form native Kv4 channel complexes. The encoded protein may regulate rapidly inactivating (A-type) currents, and hence neuronal membrane excitability, in response to changes in the concentration of intracellular calcium. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increase susceptibility to pentylenetetrazole-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T A 18: 10,706,032 I94F probably damaging Het
Bbox1 A T 2: 110,270,077 D258E probably benign Het
Catsperb A G 12: 101,412,568 probably null Het
Ccdc127 T C 13: 74,356,921 V196A probably benign Het
Cd101 A T 3: 101,018,643 D253E probably damaging Het
Ceacam15 T C 7: 16,673,289 Y101C probably damaging Het
Cep135 C T 5: 76,624,723 L652F probably benign Het
Col5a1 G T 2: 28,032,621 V234L probably benign Het
Cxcr6 T C 9: 123,810,008 S25P possibly damaging Het
D17Wsu92e A T 17: 27,767,986 D255E probably benign Het
Dctn4 C T 18: 60,546,793 Q258* probably null Het
Fmnl2 A T 2: 53,130,445 N1067I possibly damaging Het
Frrs1 A T 3: 116,878,431 K59N probably benign Het
Gpr157 T C 4: 150,101,598 Y206H probably damaging Het
Hephl1 A G 9: 15,090,564 Y161H possibly damaging Het
Hinfp C T 9: 44,298,872 probably null Het
Igf2r A T 17: 12,714,951 N805K probably damaging Het
Itga3 T C 11: 95,068,891 probably benign Het
Itga6 A G 2: 71,834,007 probably null Het
Lig4 T C 8: 9,971,585 T732A probably benign Het
Lmod3 T A 6: 97,247,301 T520S probably damaging Het
Megf8 G A 7: 25,343,720 V1356I possibly damaging Het
Mical3 C T 6: 121,040,517 probably null Het
Msi1 T C 5: 115,435,476 I8T probably damaging Het
Mug4-ps A T 6: 121,950,317 noncoding transcript Het
Myo1f T A 17: 33,601,070 I783N probably damaging Het
Nr6a1 A C 2: 38,729,497 I462S probably damaging Het
Olfr1056 A G 2: 86,356,358 V8A probably benign Het
Olfr330 C T 11: 58,529,264 A241T probably damaging Het
Pah C A 10: 87,583,561 Q449K probably benign Het
Pced1a A G 2: 130,421,919 V271A probably damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Psg21 A G 7: 18,652,345 Y239H probably damaging Het
Ptprt T C 2: 162,268,029 Y180C probably damaging Het
Raet1d T A 10: 22,370,950 I59N probably damaging Het
Rfx1 T C 8: 84,093,018 L653P probably damaging Het
Rnase2a A G 14: 51,255,674 V78A possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Serbp1 T C 6: 67,272,867 probably benign Het
Tlr1 A T 5: 64,925,286 H649Q probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc6 T A 9: 8,656,730 D719E probably benign Het
Ttc21b A T 2: 66,236,354 S318R probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Uhmk1 T C 1: 170,212,237 Q187R probably damaging Het
Ung C T 5: 114,131,377 A50V probably benign Het
Upk3bl C T 5: 136,059,820 Q103* probably null Het
Usp17le C A 7: 104,769,143 C264F probably damaging Het
Vmn2r105 T A 17: 20,228,496 N140Y probably damaging Het
Vmn2r84 C T 10: 130,386,245 C702Y probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp748 G A 13: 67,540,804 P779L possibly damaging Het
Other mutations in Kcnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Kcnip1 APN 11 33643289 splice site probably benign
IGL00597:Kcnip1 APN 11 33643294 critical splice donor site probably null
IGL01064:Kcnip1 APN 11 33633192 missense probably damaging 1.00
IGL01125:Kcnip1 APN 11 33633202 missense probably damaging 1.00
IGL01324:Kcnip1 APN 11 33645603 start codon destroyed probably null 0.01
IGL01409:Kcnip1 APN 11 33630593 missense probably benign 0.00
IGL02622:Kcnip1 APN 11 33643290 splice site probably benign
R0149:Kcnip1 UTSW 11 33843177 missense probably benign
R0319:Kcnip1 UTSW 11 33651529 splice site probably benign
R0361:Kcnip1 UTSW 11 33843177 missense probably benign
R1314:Kcnip1 UTSW 11 33642481 missense probably damaging 1.00
R3420:Kcnip1 UTSW 11 33645594 missense probably damaging 1.00
R3421:Kcnip1 UTSW 11 33645594 missense probably damaging 1.00
R3422:Kcnip1 UTSW 11 33645594 missense probably damaging 1.00
R4631:Kcnip1 UTSW 11 33992821 exon noncoding transcript
R4843:Kcnip1 UTSW 11 33644504 missense probably benign 0.00
R5007:Kcnip1 UTSW 11 33642495 missense probably benign 0.05
R5337:Kcnip1 UTSW 11 33642389 intron probably benign
R5596:Kcnip1 UTSW 11 33630597 missense probably damaging 1.00
R6058:Kcnip1 UTSW 11 33642478 missense probably damaging 1.00
R7086:Kcnip1 UTSW 11 33634629 missense probably damaging 1.00
R7363:Kcnip1 UTSW 11 33634589 missense probably benign 0.00
R7881:Kcnip1 UTSW 11 33633206 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGGCATGGGAAAAGCTTAGG -3'
(R):5'- ACAGATTGTGAAGCAGGCTG -3'

Sequencing Primer
(F):5'- GCAAGTGGCAAAAATCACAGC -3'
(R):5'- ATTGTGAAGCAGGCTGAGTGG -3'
Posted On2018-02-27