Incidental Mutation 'R6210:Itga3'
ID503417
Institutional Source Beutler Lab
Gene Symbol Itga3
Ensembl Gene ENSMUSG00000001507
Gene Nameintegrin alpha 3
SynonymsVLA-3 alpha 3, alpha3-integrin
MMRRC Submission 044344-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6210 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location95044474-95076801 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 95068891 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000001548] [ENSMUST00000107739] [ENSMUST00000120375]
Predicted Effect probably benign
Transcript: ENSMUST00000001548
SMART Domains Protein: ENSMUSP00000001548
Gene: ENSMUSG00000001507

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Int_alpha 48 110 4.18e-7 SMART
Int_alpha 246 300 5.01e0 SMART
Int_alpha 304 361 3.07e-14 SMART
Int_alpha 366 419 4.17e-16 SMART
Int_alpha 427 483 7.57e1 SMART
low complexity region 521 534 N/A INTRINSIC
SCOP:d1m1xa3 758 984 7e-54 SMART
transmembrane domain 994 1016 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000107739
AA Change: D21G
SMART Domains Protein: ENSMUSP00000103368
Gene: ENSMUSG00000001507
AA Change: D21G

DomainStartEndE-ValueType
Int_alpha 20 79 1.05e2 SMART
Int_alpha 215 269 5.01e0 SMART
Int_alpha 273 330 3.07e-14 SMART
Int_alpha 335 388 4.17e-16 SMART
Int_alpha 396 452 7.57e1 SMART
low complexity region 490 503 N/A INTRINSIC
low complexity region 775 789 N/A INTRINSIC
transmembrane domain 963 985 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120375
SMART Domains Protein: ENSMUSP00000113556
Gene: ENSMUSG00000001507

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Int_alpha 48 110 4.18e-7 SMART
Int_alpha 246 300 5.01e0 SMART
Int_alpha 304 361 3.07e-14 SMART
Int_alpha 366 419 4.17e-16 SMART
Int_alpha 427 483 7.57e1 SMART
low complexity region 521 534 N/A INTRINSIC
SCOP:d1m1xa3 758 984 2e-53 SMART
transmembrane domain 994 1016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145671
SMART Domains Protein: ENSMUSP00000115970
Gene: ENSMUSG00000001507

DomainStartEndE-ValueType
Blast:Int_alpha 6 52 3e-22 BLAST
SCOP:d1m1xa4 8 182 3e-24 SMART
PDB:4IRZ|A 12 168 2e-8 PDB
Blast:Int_alpha 55 88 2e-6 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: This gene encodes a subunit of integrin family of cell surface proteins. The encoded protein undergoes post-translational processing to form a disulfide bond-linked dimer comprised of heavy and light chains. At the cell surface, the encoded protein non-covalently associates with the integrin beta-1 subunit to form a heterodimer that interacts with many extracellular matrix proteins including fibronectin and laminin. Mice lacking the encoded protein die during the first day after birth due to severe abnormalities in kidneys. Mice lacking the encoded protein specifically in the basal layer of epidermis display several skin defects and accelerated wound healing. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the kidney and submandibular gland, decreased bronchial branching of the lungs, skin blisters at the dermal-epidermal junction, abnormal layering of the cerebral cortex and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T A 18: 10,706,032 I94F probably damaging Het
Bbox1 A T 2: 110,270,077 D258E probably benign Het
Catsperb A G 12: 101,412,568 probably null Het
Ccdc127 T C 13: 74,356,921 V196A probably benign Het
Cd101 A T 3: 101,018,643 D253E probably damaging Het
Ceacam15 T C 7: 16,673,289 Y101C probably damaging Het
Cep135 C T 5: 76,624,723 L652F probably benign Het
Col5a1 G T 2: 28,032,621 V234L probably benign Het
Cxcr6 T C 9: 123,810,008 S25P possibly damaging Het
D17Wsu92e A T 17: 27,767,986 D255E probably benign Het
Dctn4 C T 18: 60,546,793 Q258* probably null Het
Fmnl2 A T 2: 53,130,445 N1067I possibly damaging Het
Frrs1 A T 3: 116,878,431 K59N probably benign Het
Gpr157 T C 4: 150,101,598 Y206H probably damaging Het
Hephl1 A G 9: 15,090,564 Y161H possibly damaging Het
Hinfp C T 9: 44,298,872 probably null Het
Igf2r A T 17: 12,714,951 N805K probably damaging Het
Itga6 A G 2: 71,834,007 probably null Het
Kcnip1 G A 11: 33,645,600 T30I possibly damaging Het
Lig4 T C 8: 9,971,585 T732A probably benign Het
Lmod3 T A 6: 97,247,301 T520S probably damaging Het
Megf8 G A 7: 25,343,720 V1356I possibly damaging Het
Mical3 C T 6: 121,040,517 probably null Het
Msi1 T C 5: 115,435,476 I8T probably damaging Het
Mug4-ps A T 6: 121,950,317 noncoding transcript Het
Myo1f T A 17: 33,601,070 I783N probably damaging Het
Nr6a1 A C 2: 38,729,497 I462S probably damaging Het
Olfr1056 A G 2: 86,356,358 V8A probably benign Het
Olfr330 C T 11: 58,529,264 A241T probably damaging Het
Pah C A 10: 87,583,561 Q449K probably benign Het
Pced1a A G 2: 130,421,919 V271A probably damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Psg21 A G 7: 18,652,345 Y239H probably damaging Het
Ptprt T C 2: 162,268,029 Y180C probably damaging Het
Raet1d T A 10: 22,370,950 I59N probably damaging Het
Rfx1 T C 8: 84,093,018 L653P probably damaging Het
Rnase2a A G 14: 51,255,674 V78A possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Serbp1 T C 6: 67,272,867 probably benign Het
Tlr1 A T 5: 64,925,286 H649Q probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc6 T A 9: 8,656,730 D719E probably benign Het
Ttc21b A T 2: 66,236,354 S318R probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Uhmk1 T C 1: 170,212,237 Q187R probably damaging Het
Ung C T 5: 114,131,377 A50V probably benign Het
Upk3bl C T 5: 136,059,820 Q103* probably null Het
Usp17le C A 7: 104,769,143 C264F probably damaging Het
Vmn2r105 T A 17: 20,228,496 N140Y probably damaging Het
Vmn2r84 C T 10: 130,386,245 C702Y probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp748 G A 13: 67,540,804 P779L possibly damaging Het
Other mutations in Itga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Itga3 APN 11 95065886 missense probably damaging 1.00
IGL02020:Itga3 APN 11 95057390 missense probably benign 0.02
IGL02413:Itga3 APN 11 95068771 missense probably damaging 1.00
IGL02562:Itga3 APN 11 95068793 missense probably benign 0.02
PIT4508001:Itga3 UTSW 11 95055893 missense probably benign 0.20
R0485:Itga3 UTSW 11 95061970 missense probably benign 0.05
R1548:Itga3 UTSW 11 95046919 critical splice donor site probably null
R1677:Itga3 UTSW 11 95055759 missense probably damaging 0.96
R2062:Itga3 UTSW 11 95054076 missense possibly damaging 0.92
R2088:Itga3 UTSW 11 95052494 missense probably benign 0.10
R2679:Itga3 UTSW 11 95068310 splice site probably benign
R3697:Itga3 UTSW 11 95062725 missense probably benign 0.00
R3839:Itga3 UTSW 11 95057269 critical splice donor site probably null
R4210:Itga3 UTSW 11 95062623 missense probably benign 0.00
R4533:Itga3 UTSW 11 95057293 missense probably benign 0.15
R4849:Itga3 UTSW 11 95076271 missense probably benign
R4863:Itga3 UTSW 11 95061967 missense probably damaging 1.00
R4889:Itga3 UTSW 11 95068301 missense probably benign 0.13
R5218:Itga3 UTSW 11 95062748 missense probably benign 0.01
R6046:Itga3 UTSW 11 95062715 missense probably benign 0.28
R6087:Itga3 UTSW 11 95052443 critical splice donor site probably null
R6341:Itga3 UTSW 11 95055851 splice site probably null
R6666:Itga3 UTSW 11 95065826 missense probably benign 0.00
R6998:Itga3 UTSW 11 95051462 missense probably benign 0.00
R7106:Itga3 UTSW 11 95055873 missense probably benign 0.00
R7164:Itga3 UTSW 11 95052479 missense possibly damaging 0.85
R7267:Itga3 UTSW 11 95076362 intron probably benign
R7421:Itga3 UTSW 11 95068855 missense probably benign 0.20
R7514:Itga3 UTSW 11 95065896 nonsense probably null
R7533:Itga3 UTSW 11 95046518 missense probably benign 0.45
R7736:Itga3 UTSW 11 95076203 missense probably damaging 1.00
R8145:Itga3 UTSW 11 95052464 missense probably damaging 1.00
R8303:Itga3 UTSW 11 95062640 missense probably benign 0.42
R8459:Itga3 UTSW 11 95068807 missense probably benign
R8464:Itga3 UTSW 11 95062740 missense probably benign 0.28
R8951:Itga3 UTSW 11 95054085 missense probably damaging 0.99
Z1177:Itga3 UTSW 11 95056774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTCCATCCGTTCACAGTC -3'
(R):5'- CCTGGCCCCTGTACATATTG -3'

Sequencing Primer
(F):5'- TCACAGTCGTCCTTGTGGGC -3'
(R):5'- ATTGTCCTTACTCTGAGGCCAGG -3'
Posted On2018-02-27