Incidental Mutation 'R6210:Zfp748'
ID503419
Institutional Source Beutler Lab
Gene Symbol Zfp748
Ensembl Gene ENSMUSG00000095432
Gene Namezinc finger protein 748
Synonyms2610014M12Rik, mszf54, Zfp208, KRAB-O
MMRRC Submission 044344-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6210 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location67538641-67553830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67540804 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 779 (P779L)
Ref Sequence ENSEMBL: ENSMUSP00000137928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000181892]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000053289
SMART Domains Protein: ENSMUSP00000080439
Gene: ENSMUSG00000095432

DomainStartEndE-ValueType
KRAB 5 65 3.39e-35 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000181892
AA Change: P779L

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137928
Gene: ENSMUSG00000095432
AA Change: P779L

DomainStartEndE-ValueType
KRAB 5 65 3.39e-35 SMART
ZnF_C2H2 81 101 1.59e1 SMART
low complexity region 133 144 N/A INTRINSIC
ZnF_C2H2 165 187 5.14e-3 SMART
ZnF_C2H2 193 215 2.71e-2 SMART
ZnF_C2H2 277 298 7.37e1 SMART
ZnF_C2H2 304 326 1.95e-3 SMART
ZnF_C2H2 332 354 8.94e-3 SMART
ZnF_C2H2 360 382 2.61e-4 SMART
ZnF_C2H2 388 410 5.9e-3 SMART
ZnF_C2H2 416 438 3.44e-4 SMART
ZnF_C2H2 444 466 3.89e-3 SMART
ZnF_C2H2 472 494 4.79e-3 SMART
ZnF_C2H2 500 522 1.6e-4 SMART
ZnF_C2H2 528 550 1.18e-2 SMART
ZnF_C2H2 556 578 1.12e-3 SMART
ZnF_C2H2 584 606 3.89e-3 SMART
ZnF_C2H2 612 634 2.95e-3 SMART
ZnF_C2H2 640 662 1.6e-4 SMART
ZnF_C2H2 668 690 2.95e-3 SMART
ZnF_C2H2 696 718 2.12e-4 SMART
ZnF_C2H2 724 746 4.47e-3 SMART
ZnF_C2H2 752 774 1.12e-3 SMART
ZnF_C2H2 780 802 3.89e-3 SMART
ZnF_C2H2 808 830 1.47e-3 SMART
ZnF_C2H2 836 858 4.87e-4 SMART
ZnF_C2H2 864 886 7.9e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T A 18: 10,706,032 I94F probably damaging Het
Bbox1 A T 2: 110,270,077 D258E probably benign Het
Catsperb A G 12: 101,412,568 probably null Het
Ccdc127 T C 13: 74,356,921 V196A probably benign Het
Cd101 A T 3: 101,018,643 D253E probably damaging Het
Ceacam15 T C 7: 16,673,289 Y101C probably damaging Het
Cep135 C T 5: 76,624,723 L652F probably benign Het
Col5a1 G T 2: 28,032,621 V234L probably benign Het
Cxcr6 T C 9: 123,810,008 S25P possibly damaging Het
D17Wsu92e A T 17: 27,767,986 D255E probably benign Het
Dctn4 C T 18: 60,546,793 Q258* probably null Het
Fmnl2 A T 2: 53,130,445 N1067I possibly damaging Het
Frrs1 A T 3: 116,878,431 K59N probably benign Het
Gpr157 T C 4: 150,101,598 Y206H probably damaging Het
Hephl1 A G 9: 15,090,564 Y161H possibly damaging Het
Hinfp C T 9: 44,298,872 probably null Het
Igf2r A T 17: 12,714,951 N805K probably damaging Het
Itga3 T C 11: 95,068,891 probably benign Het
Itga6 A G 2: 71,834,007 probably null Het
Kcnip1 G A 11: 33,645,600 T30I possibly damaging Het
Lig4 T C 8: 9,971,585 T732A probably benign Het
Lmod3 T A 6: 97,247,301 T520S probably damaging Het
Megf8 G A 7: 25,343,720 V1356I possibly damaging Het
Mical3 C T 6: 121,040,517 probably null Het
Msi1 T C 5: 115,435,476 I8T probably damaging Het
Mug4-ps A T 6: 121,950,317 noncoding transcript Het
Myo1f T A 17: 33,601,070 I783N probably damaging Het
Nr6a1 A C 2: 38,729,497 I462S probably damaging Het
Olfr1056 A G 2: 86,356,358 V8A probably benign Het
Olfr330 C T 11: 58,529,264 A241T probably damaging Het
Pah C A 10: 87,583,561 Q449K probably benign Het
Pced1a A G 2: 130,421,919 V271A probably damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Psg21 A G 7: 18,652,345 Y239H probably damaging Het
Ptprt T C 2: 162,268,029 Y180C probably damaging Het
Raet1d T A 10: 22,370,950 I59N probably damaging Het
Rfx1 T C 8: 84,093,018 L653P probably damaging Het
Rnase2a A G 14: 51,255,674 V78A possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Serbp1 T C 6: 67,272,867 probably benign Het
Tlr1 A T 5: 64,925,286 H649Q probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc6 T A 9: 8,656,730 D719E probably benign Het
Ttc21b A T 2: 66,236,354 S318R probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Uhmk1 T C 1: 170,212,237 Q187R probably damaging Het
Ung C T 5: 114,131,377 A50V probably benign Het
Upk3bl C T 5: 136,059,820 Q103* probably null Het
Usp17le C A 7: 104,769,143 C264F probably damaging Het
Vmn2r105 T A 17: 20,228,496 N140Y probably damaging Het
Vmn2r84 C T 10: 130,386,245 C702Y probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Zfp748
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02366:Zfp748 APN 13 67545427 splice site probably benign
R0440:Zfp748 UTSW 13 67553025 splice site probably null
R0790:Zfp748 UTSW 13 67545362 missense probably benign 0.03
R1760:Zfp748 UTSW 13 67545421 critical splice acceptor site probably null
R2520:Zfp748 UTSW 13 67546662 missense possibly damaging 0.84
R3711:Zfp748 UTSW 13 67540796 missense probably damaging 1.00
R4157:Zfp748 UTSW 13 67542106 missense possibly damaging 0.80
R4288:Zfp748 UTSW 13 67541083 missense probably damaging 1.00
R4289:Zfp748 UTSW 13 67541083 missense probably damaging 1.00
R5091:Zfp748 UTSW 13 67541519 missense probably damaging 1.00
R5441:Zfp748 UTSW 13 67540618 missense probably damaging 1.00
R5686:Zfp748 UTSW 13 67542528 nonsense probably null
R5907:Zfp748 UTSW 13 67541173 missense possibly damaging 0.87
R6268:Zfp748 UTSW 13 67542586 missense possibly damaging 0.77
R6639:Zfp748 UTSW 13 67542905 missense probably damaging 1.00
R6810:Zfp748 UTSW 13 67541725 missense probably damaging 1.00
R7148:Zfp748 UTSW 13 67542239 missense possibly damaging 0.96
R7464:Zfp748 UTSW 13 67541972 missense probably damaging 1.00
R7593:Zfp748 UTSW 13 67542519 missense probably benign 0.20
R7644:Zfp748 UTSW 13 67541449 missense probably damaging 0.99
R7799:Zfp748 UTSW 13 67541489 missense probably benign 0.02
R8872:Zfp748 UTSW 13 67541795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTGATGCTCCTTAAGTCGAGAAG -3'
(R):5'- CTCAAGAGAATCCTTACAAGTGTG -3'

Sequencing Primer
(F):5'- ACACTCTTCACACTTGTAGGG -3'
(R):5'- CCTTACAAGTGTGAAATATGTGGC -3'
Posted On2018-02-27