Incidental Mutation 'R6210:Ccdc127'
ID503420
Institutional Source Beutler Lab
Gene Symbol Ccdc127
Ensembl Gene ENSMUSG00000021578
Gene Namecoiled-coil domain containing 127
Synonyms
MMRRC Submission 044344-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6210 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location74350309-74365783 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74356921 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 196 (V196A)
Ref Sequence ENSEMBL: ENSMUSP00000022063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022063] [ENSMUST00000022064] [ENSMUST00000159931] [ENSMUST00000160021] [ENSMUST00000162376] [ENSMUST00000162672]
Predicted Effect probably benign
Transcript: ENSMUST00000022063
AA Change: V196A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022063
Gene: ENSMUSG00000021578
AA Change: V196A

DomainStartEndE-ValueType
coiled coil region 78 140 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000022064
SMART Domains Protein: ENSMUSP00000022064
Gene: ENSMUSG00000021579

DomainStartEndE-ValueType
SCOP:d1a4ya_ 208 417 8e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159931
SMART Domains Protein: ENSMUSP00000124009
Gene: ENSMUSG00000021578

DomainStartEndE-ValueType
transmembrane domain 26 45 N/A INTRINSIC
coiled coil region 78 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160021
SMART Domains Protein: ENSMUSP00000124193
Gene: ENSMUSG00000021578

DomainStartEndE-ValueType
transmembrane domain 26 45 N/A INTRINSIC
coiled coil region 78 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162376
AA Change: V196A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123805
Gene: ENSMUSG00000021578
AA Change: V196A

DomainStartEndE-ValueType
transmembrane domain 26 45 N/A INTRINSIC
coiled coil region 78 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223491
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T A 18: 10,706,032 I94F probably damaging Het
Bbox1 A T 2: 110,270,077 D258E probably benign Het
Catsperb A G 12: 101,412,568 probably null Het
Cd101 A T 3: 101,018,643 D253E probably damaging Het
Ceacam15 T C 7: 16,673,289 Y101C probably damaging Het
Cep135 C T 5: 76,624,723 L652F probably benign Het
Col5a1 G T 2: 28,032,621 V234L probably benign Het
Cxcr6 T C 9: 123,810,008 S25P possibly damaging Het
D17Wsu92e A T 17: 27,767,986 D255E probably benign Het
Dctn4 C T 18: 60,546,793 Q258* probably null Het
Fmnl2 A T 2: 53,130,445 N1067I possibly damaging Het
Frrs1 A T 3: 116,878,431 K59N probably benign Het
Gpr157 T C 4: 150,101,598 Y206H probably damaging Het
Hephl1 A G 9: 15,090,564 Y161H possibly damaging Het
Hinfp C T 9: 44,298,872 probably null Het
Igf2r A T 17: 12,714,951 N805K probably damaging Het
Itga3 T C 11: 95,068,891 probably benign Het
Itga6 A G 2: 71,834,007 probably null Het
Kcnip1 G A 11: 33,645,600 T30I possibly damaging Het
Lig4 T C 8: 9,971,585 T732A probably benign Het
Lmod3 T A 6: 97,247,301 T520S probably damaging Het
Megf8 G A 7: 25,343,720 V1356I possibly damaging Het
Mical3 C T 6: 121,040,517 probably null Het
Msi1 T C 5: 115,435,476 I8T probably damaging Het
Mug4-ps A T 6: 121,950,317 noncoding transcript Het
Myo1f T A 17: 33,601,070 I783N probably damaging Het
Nr6a1 A C 2: 38,729,497 I462S probably damaging Het
Olfr1056 A G 2: 86,356,358 V8A probably benign Het
Olfr330 C T 11: 58,529,264 A241T probably damaging Het
Pah C A 10: 87,583,561 Q449K probably benign Het
Pced1a A G 2: 130,421,919 V271A probably damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Psg21 A G 7: 18,652,345 Y239H probably damaging Het
Ptprt T C 2: 162,268,029 Y180C probably damaging Het
Raet1d T A 10: 22,370,950 I59N probably damaging Het
Rfx1 T C 8: 84,093,018 L653P probably damaging Het
Rnase2a A G 14: 51,255,674 V78A possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Serbp1 T C 6: 67,272,867 probably benign Het
Tlr1 A T 5: 64,925,286 H649Q probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc6 T A 9: 8,656,730 D719E probably benign Het
Ttc21b A T 2: 66,236,354 S318R probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Uhmk1 T C 1: 170,212,237 Q187R probably damaging Het
Ung C T 5: 114,131,377 A50V probably benign Het
Upk3bl C T 5: 136,059,820 Q103* probably null Het
Usp17le C A 7: 104,769,143 C264F probably damaging Het
Vmn2r105 T A 17: 20,228,496 N140Y probably damaging Het
Vmn2r84 C T 10: 130,386,245 C702Y probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp748 G A 13: 67,540,804 P779L possibly damaging Het
Other mutations in Ccdc127
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02524:Ccdc127 APN 13 74352897 missense probably damaging 1.00
IGL02715:Ccdc127 APN 13 74356774 missense probably benign 0.00
R0295:Ccdc127 UTSW 13 74356870 missense probably damaging 1.00
R1428:Ccdc127 UTSW 13 74356915 missense probably benign 0.37
R1861:Ccdc127 UTSW 13 74356979 missense possibly damaging 0.95
R4671:Ccdc127 UTSW 13 74357045 nonsense probably null
R4738:Ccdc127 UTSW 13 74357068 intron probably benign
R5719:Ccdc127 UTSW 13 74357068 intron probably benign
R6742:Ccdc127 UTSW 13 74352923 missense probably damaging 1.00
R6842:Ccdc127 UTSW 13 74356969 missense probably damaging 1.00
R7046:Ccdc127 UTSW 13 74352875 missense probably damaging 1.00
R7161:Ccdc127 UTSW 13 74352877 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATTTGAGCTGCCTGCAAG -3'
(R):5'- TTTTGGTGGCAAAGGAACAG -3'

Sequencing Primer
(F):5'- CTATTTGAGCTGCCTGCAAGAAGAG -3'
(R):5'- AGACTGCAGACTGCCATGG -3'
Posted On2018-02-27