Mutagenetix > Incidental Mutation

Incidental Mutation 'R6210:Pdzrn4'

503422

Institutional Source

Beutler Lab

Gene Symbol

Pdzrn4

Ensembl Gene

ENSMUSG00000036218

Gene Name

PDZ domain containing RING finger 4

Synonyms

1110017D07Rik, LNX4, SAMCAP3L

MMRRC Submission

044344-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.251) question?

Stock #

R6210 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

92396881-92771819 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 92757681 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 485 (E485V)

Ref Sequence

ENSEMBL: ENSMUSP00000133159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]

AlphaFold

E9PUZ9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035399
AA Change: E246V

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: E246V

Domain	Start	End	E-Value	Type
Blast:PDZ	1	56	4e-24	BLAST
SCOP:d1qaua_	20	61	1e-3	SMART
PDB:1UHP\|A	21	64	9e-12	PDB
PDZ	154	229	3.01e-18	SMART
low complexity region	240	259	N/A	INTRINSIC
low complexity region	267	278	N/A	INTRINSIC
coiled coil region	394	430	N/A	INTRINSIC
low complexity region	563	577	N/A	INTRINSIC
low complexity region	696	709	N/A	INTRINSIC
low complexity region	732	741	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169942
AA Change: E485V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: E485V

Domain	Start	End	E-Value	Type
RING	22	56	1.38e-1	SMART
low complexity region	101	124	N/A	INTRINSIC
PDZ	213	295	3.82e-20	SMART
PDZ	393	468	3.01e-18	SMART
low complexity region	479	498	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
coiled coil region	633	669	N/A	INTRINSIC
low complexity region	802	816	N/A	INTRINSIC
low complexity region	935	948	N/A	INTRINSIC
low complexity region	971	980	N/A	INTRINSIC

Meta Mutation Damage Score

0.1919

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

95% (52/55)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd3	T	A	18: 10,706,032	I94F	probably damaging	Het
Bbox1	A	T	2: 110,270,077	D258E	probably benign	Het
Catsperb	A	G	12: 101,412,568		probably null	Het
Ccdc127	T	C	13: 74,356,921	V196A	probably benign	Het
Cd101	A	T	3: 101,018,643	D253E	probably damaging	Het
Ceacam15	T	C	7: 16,673,289	Y101C	probably damaging	Het
Cep135	C	T	5: 76,624,723	L652F	probably benign	Het
Col5a1	G	T	2: 28,032,621	V234L	probably benign	Het
Cxcr6	T	C	9: 123,810,008	S25P	possibly damaging	Het
D17Wsu92e	A	T	17: 27,767,986	D255E	probably benign	Het
Dctn4	C	T	18: 60,546,793	Q258*	probably null	Het
Fmnl2	A	T	2: 53,130,445	N1067I	possibly damaging	Het
Frrs1	A	T	3: 116,878,431	K59N	probably benign	Het
Gpr157	T	C	4: 150,101,598	Y206H	probably damaging	Het
Hephl1	A	G	9: 15,090,564	Y161H	possibly damaging	Het
Hinfp	C	T	9: 44,298,872		probably null	Het
Igf2r	A	T	17: 12,714,951	N805K	probably damaging	Het
Itga3	T	C	11: 95,068,891		probably benign	Het
Itga6	A	G	2: 71,834,007		probably null	Het
Kcnip1	G	A	11: 33,645,600	T30I	possibly damaging	Het
Lig4	T	C	8: 9,971,585	T732A	probably benign	Het
Lmod3	T	A	6: 97,247,301	T520S	probably damaging	Het
Megf8	G	A	7: 25,343,720	V1356I	possibly damaging	Het
Mical3	C	T	6: 121,040,517		probably null	Het
Msi1	T	C	5: 115,435,476	I8T	probably damaging	Het
Mug4-ps	A	T	6: 121,950,317		noncoding transcript	Het
Myo1f	T	A	17: 33,601,070	I783N	probably damaging	Het
Nr6a1	A	C	2: 38,729,497	I462S	probably damaging	Het
Olfr1056	A	G	2: 86,356,358	V8A	probably benign	Het
Olfr330	C	T	11: 58,529,264	A241T	probably damaging	Het
Pah	C	A	10: 87,583,561	Q449K	probably benign	Het
Pced1a	A	G	2: 130,421,919	V271A	probably damaging	Het
Psg21	A	G	7: 18,652,345	Y239H	probably damaging	Het
Ptprt	T	C	2: 162,268,029	Y180C	probably damaging	Het
Raet1d	T	A	10: 22,370,950	I59N	probably damaging	Het
Rfx1	T	C	8: 84,093,018	L653P	probably damaging	Het
Rnase2a	A	G	14: 51,255,674	V78A	possibly damaging	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Homo
Serbp1	T	C	6: 67,272,867		probably benign	Het
Tlr1	A	T	5: 64,925,286	H649Q	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trpc6	T	A	9: 8,656,730	D719E	probably benign	Het
Ttc21b	A	T	2: 66,236,354	S318R	probably benign	Het
Ttn	G	A	2: 76,749,329	T23740M	probably damaging	Het
Uhmk1	T	C	1: 170,212,237	Q187R	probably damaging	Het
Ung	C	T	5: 114,131,377	A50V	probably benign	Het
Upk3bl	C	T	5: 136,059,820	Q103*	probably null	Het
Usp17le	C	A	7: 104,769,143	C264F	probably damaging	Het
Vmn2r105	T	A	17: 20,228,496	N140Y	probably damaging	Het
Vmn2r84	C	T	10: 130,386,245	C702Y	probably damaging	Het
Zfp709	TCGACG	TCG	8: 71,890,708		probably benign	Het
Zfp748	G	A	13: 67,540,804	P779L	possibly damaging	Het

Other mutations in Pdzrn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01932:Pdzrn4	APN	15	92746278	missense	probably damaging	1.00
IGL01991:Pdzrn4	APN	15	92401926	splice site	probably null
IGL02103:Pdzrn4	APN	15	92769887	missense	probably damaging	1.00
IGL02243:Pdzrn4	APN	15	92770696	missense	probably benign	0.30
IGL02269:Pdzrn4	APN	15	92769850	missense	probably damaging	1.00
IGL03005:Pdzrn4	APN	15	92770391	missense	probably damaging	1.00
PIT4362001:Pdzrn4	UTSW	15	92769881	missense	possibly damaging	0.46
R0243:Pdzrn4	UTSW	15	92770319	missense	possibly damaging	0.46
R0367:Pdzrn4	UTSW	15	92757657	missense	possibly damaging	0.53
R0972:Pdzrn4	UTSW	15	92757711	missense	probably benign	0.00
R1168:Pdzrn4	UTSW	15	92770271	missense	probably benign	0.16
R1411:Pdzrn4	UTSW	15	92771013	makesense	probably null
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1489:Pdzrn4	UTSW	15	92677712	missense	probably benign
R1503:Pdzrn4	UTSW	15	92399804	missense	probably damaging	0.99
R1561:Pdzrn4	UTSW	15	92677637	missense	possibly damaging	0.84
R1584:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1733:Pdzrn4	UTSW	15	92401974	missense	probably benign	0.06
R1965:Pdzrn4	UTSW	15	92746309	splice site	probably null
R2061:Pdzrn4	UTSW	15	92770160	missense	probably damaging	0.99
R3010:Pdzrn4	UTSW	15	92769811	missense	probably benign	0.32
R4016:Pdzrn4	UTSW	15	92399749	missense	probably benign
R4032:Pdzrn4	UTSW	15	92769533	missense	probably damaging	1.00
R4110:Pdzrn4	UTSW	15	92770864	missense	probably benign	0.26
R4180:Pdzrn4	UTSW	15	92402017	missense	possibly damaging	0.93
R4539:Pdzrn4	UTSW	15	92770589	missense	probably damaging	1.00
R4617:Pdzrn4	UTSW	15	92769842	missense	probably damaging	1.00
R4734:Pdzrn4	UTSW	15	92770252	nonsense	probably null
R4900:Pdzrn4	UTSW	15	92770757	missense	probably damaging	1.00
R5422:Pdzrn4	UTSW	15	92677621	missense	probably benign	0.01
R5444:Pdzrn4	UTSW	15	92770925	missense	probably damaging	1.00
R5772:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5775:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5935:Pdzrn4	UTSW	15	92397374	missense	probably benign	0.01
R6192:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6258:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6259:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6391:Pdzrn4	UTSW	15	92680537	missense	probably damaging	0.99
R6613:Pdzrn4	UTSW	15	92677574	missense	probably damaging	0.99
R7046:Pdzrn4	UTSW	15	92770422	nonsense	probably null
R7096:Pdzrn4	UTSW	15	92397503	missense	probably benign	0.00
R7451:Pdzrn4	UTSW	15	92770067	missense	possibly damaging	0.68
R8075:Pdzrn4	UTSW	15	92677724	missense	probably damaging	0.99
R8125:Pdzrn4	UTSW	15	92743595	missense	probably damaging	1.00
R8324:Pdzrn4	UTSW	15	92770937	missense	probably damaging	1.00
R9332:Pdzrn4	UTSW	15	92397335	missense	probably benign
R9555:Pdzrn4	UTSW	15	92399822	missense	probably damaging	1.00
R9558:Pdzrn4	UTSW	15	92401996	missense	possibly damaging	0.46
R9622:Pdzrn4	UTSW	15	92397068	missense	probably benign
R9763:Pdzrn4	UTSW	15	92770495	missense	probably damaging	1.00
R9796:Pdzrn4	UTSW	15	92680472	missense	possibly damaging	0.93
X0018:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0020:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0021:Pdzrn4	UTSW	15	92677709	missense	probably damaging	1.00
X0026:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92680512	missense	possibly damaging	0.92
X0065:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
Z1176:Pdzrn4	UTSW	15	92396957	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TCTAAAGCTGTTTCAGGAGAGG -3'
(R):5'- TCGTTTGCCCCGAAAGATTATG -3'

Sequencing Primer
(F):5'- CTTCTTTCTGAGAGGTGACCAGAG -3'
(R):5'- CGTTTGCCCCGAAAGATTATGATTAG -3'

Posted On

2018-02-27