Incidental Mutation 'R6210:Igf2r'
ID 503424
Institutional Source Beutler Lab
Gene Symbol Igf2r
Ensembl Gene ENSMUSG00000023830
Gene Name insulin-like growth factor 2 receptor
Synonyms IGF-II/CI-MPR, CD222, mannose-6-phosphate receptor, cation independent, M6P/IGF2R, Mpr300, CI-MPR
MMRRC Submission 044344-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.921) question?
Stock # R6210 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 12901293-12988551 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 12933838 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 805 (N805K)
Ref Sequence ENSEMBL: ENSMUSP00000024599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024599]
AlphaFold Q07113
Predicted Effect probably damaging
Transcript: ENSMUST00000024599
AA Change: N805K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: N805K

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
Pfam:CIMR 118 266 5.1e-21 PFAM
Pfam:CIMR 272 416 8.8e-22 PFAM
Pfam:CIMR 418 567 3.4e-53 PFAM
Pfam:CIMR 569 709 6.5e-47 PFAM
Pfam:CIMR 713 869 6.5e-34 PFAM
Pfam:CIMR 876 1020 1.9e-10 PFAM
Pfam:CIMR 1024 1171 1e-60 PFAM
Pfam:CIMR 1172 1313 1.2e-17 PFAM
Pfam:CIMR 1315 1455 2.1e-58 PFAM
Pfam:CIMR 1458 1592 1.8e-22 PFAM
Pfam:CIMR 1596 1743 9.1e-23 PFAM
Pfam:CIMR 1748 1887 2.5e-22 PFAM
FN2 1889 1935 9.51e-26 SMART
Pfam:CIMR 1939 2076 2.1e-22 PFAM
Pfam:CIMR 2230 2294 4.9e-9 PFAM
transmembrane domain 2295 2317 N/A INTRINSIC
low complexity region 2336 2363 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T A 18: 10,706,032 (GRCm39) I94F probably damaging Het
Bbox1 A T 2: 110,100,422 (GRCm39) D258E probably benign Het
Catsperb A G 12: 101,378,827 (GRCm39) probably null Het
Ccdc127 T C 13: 74,505,040 (GRCm39) V196A probably benign Het
Cd101 A T 3: 100,925,959 (GRCm39) D253E probably damaging Het
Ceacam15 T C 7: 16,407,214 (GRCm39) Y101C probably damaging Het
Cep135 C T 5: 76,772,570 (GRCm39) L652F probably benign Het
Col5a1 G T 2: 27,922,633 (GRCm39) V234L probably benign Het
Cxcr6 T C 9: 123,639,073 (GRCm39) S25P possibly damaging Het
Dctn4 C T 18: 60,679,865 (GRCm39) Q258* probably null Het
Fmnl2 A T 2: 53,020,457 (GRCm39) N1067I possibly damaging Het
Frrs1 A T 3: 116,672,080 (GRCm39) K59N probably benign Het
Gpr157 T C 4: 150,186,055 (GRCm39) Y206H probably damaging Het
Hephl1 A G 9: 15,001,860 (GRCm39) Y161H possibly damaging Het
Hinfp C T 9: 44,210,169 (GRCm39) probably null Het
Ilrun A T 17: 27,986,960 (GRCm39) D255E probably benign Het
Itga3 T C 11: 94,959,717 (GRCm39) probably benign Het
Itga6 A G 2: 71,664,351 (GRCm39) probably null Het
Kcnip1 G A 11: 33,595,600 (GRCm39) T30I possibly damaging Het
Lig4 T C 8: 10,021,585 (GRCm39) T732A probably benign Het
Lmod3 T A 6: 97,224,262 (GRCm39) T520S probably damaging Het
Megf8 G A 7: 25,043,145 (GRCm39) V1356I possibly damaging Het
Mical3 C T 6: 121,017,478 (GRCm39) probably null Het
Msi1 T C 5: 115,573,535 (GRCm39) I8T probably damaging Het
Mug4-ps A T 6: 121,927,276 (GRCm39) noncoding transcript Het
Myo1f T A 17: 33,820,044 (GRCm39) I783N probably damaging Het
Nr6a1 A C 2: 38,619,509 (GRCm39) I462S probably damaging Het
Or2t48 C T 11: 58,420,090 (GRCm39) A241T probably damaging Het
Or8k23 A G 2: 86,186,702 (GRCm39) V8A probably benign Het
Pah C A 10: 87,419,423 (GRCm39) Q449K probably benign Het
Pced1a A G 2: 130,263,839 (GRCm39) V271A probably damaging Het
Pdzrn4 A T 15: 92,655,562 (GRCm39) E485V probably damaging Het
Psg21 A G 7: 18,386,270 (GRCm39) Y239H probably damaging Het
Ptprt T C 2: 162,109,949 (GRCm39) Y180C probably damaging Het
Raet1d T A 10: 22,246,849 (GRCm39) I59N probably damaging Het
Rfx1 T C 8: 84,819,647 (GRCm39) L653P probably damaging Het
Rnase2a A G 14: 51,493,131 (GRCm39) V78A possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Homo
Serbp1 T C 6: 67,249,851 (GRCm39) probably benign Het
Tlr1 A T 5: 65,082,629 (GRCm39) H649Q probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trpc6 T A 9: 8,656,731 (GRCm39) D719E probably benign Het
Ttc21b A T 2: 66,066,698 (GRCm39) S318R probably benign Het
Ttn G A 2: 76,579,673 (GRCm39) T23740M probably damaging Het
Uhmk1 T C 1: 170,039,806 (GRCm39) Q187R probably damaging Het
Ung C T 5: 114,269,438 (GRCm39) A50V probably benign Het
Upk3bl C T 5: 136,088,674 (GRCm39) Q103* probably null Het
Usp17le C A 7: 104,418,350 (GRCm39) C264F probably damaging Het
Vmn2r105 T A 17: 20,448,758 (GRCm39) N140Y probably damaging Het
Vmn2r84 C T 10: 130,222,114 (GRCm39) C702Y probably damaging Het
Zfp709 TCGACG TCG 8: 72,644,552 (GRCm39) probably benign Het
Zfp748 G A 13: 67,688,923 (GRCm39) P779L possibly damaging Het
Other mutations in Igf2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Igf2r APN 17 12,932,877 (GRCm39) missense probably benign 0.01
IGL00534:Igf2r APN 17 12,958,215 (GRCm39) missense probably damaging 0.97
IGL00902:Igf2r APN 17 12,919,245 (GRCm39) missense probably damaging 0.99
IGL00903:Igf2r APN 17 12,902,754 (GRCm39) missense possibly damaging 0.70
IGL01160:Igf2r APN 17 12,923,662 (GRCm39) missense possibly damaging 0.73
IGL01380:Igf2r APN 17 12,914,261 (GRCm39) missense probably benign 0.01
IGL01392:Igf2r APN 17 12,923,236 (GRCm39) missense probably benign
IGL01557:Igf2r APN 17 12,923,522 (GRCm39) missense possibly damaging 0.82
IGL01568:Igf2r APN 17 12,902,872 (GRCm39) missense possibly damaging 0.93
IGL01611:Igf2r APN 17 12,944,302 (GRCm39) nonsense probably null
IGL01720:Igf2r APN 17 12,920,200 (GRCm39) missense probably damaging 0.99
IGL01756:Igf2r APN 17 12,902,709 (GRCm39) missense probably benign
IGL01839:Igf2r APN 17 12,923,909 (GRCm39) missense probably damaging 1.00
IGL01904:Igf2r APN 17 12,933,798 (GRCm39) missense probably damaging 0.99
IGL01965:Igf2r APN 17 12,923,225 (GRCm39) missense probably benign 0.12
IGL02083:Igf2r APN 17 12,912,079 (GRCm39) nonsense probably null
IGL02095:Igf2r APN 17 12,920,892 (GRCm39) missense probably damaging 0.99
IGL02183:Igf2r APN 17 12,917,403 (GRCm39) unclassified probably benign
IGL02576:Igf2r APN 17 12,967,650 (GRCm39) missense possibly damaging 0.90
IGL02649:Igf2r APN 17 12,930,974 (GRCm39) missense possibly damaging 0.93
IGL02807:Igf2r APN 17 12,938,770 (GRCm39) missense probably damaging 0.98
IGL02833:Igf2r APN 17 12,911,610 (GRCm39) missense probably damaging 0.97
IGL02885:Igf2r APN 17 12,913,007 (GRCm39) missense possibly damaging 0.94
IGL02990:Igf2r APN 17 12,929,633 (GRCm39) splice site probably benign
IGL03080:Igf2r APN 17 12,945,563 (GRCm39) missense probably benign 0.06
IGL03176:Igf2r APN 17 12,935,559 (GRCm39) missense probably damaging 1.00
blunt UTSW 17 12,941,062 (GRCm39) missense probably benign 0.02
brusque UTSW 17 12,933,838 (GRCm39) missense probably damaging 0.98
gruff UTSW 17 12,902,984 (GRCm39) missense probably damaging 0.96
outlier UTSW 17 12,914,201 (GRCm39) missense probably benign 0.20
NA:Igf2r UTSW 17 12,910,849 (GRCm39) missense probably benign
R0165:Igf2r UTSW 17 12,917,414 (GRCm39) missense probably benign 0.07
R0412:Igf2r UTSW 17 12,902,835 (GRCm39) missense probably damaging 0.98
R0523:Igf2r UTSW 17 12,910,951 (GRCm39) missense probably benign 0.27
R0631:Igf2r UTSW 17 12,936,161 (GRCm39) splice site probably null
R0722:Igf2r UTSW 17 12,934,382 (GRCm39) critical splice acceptor site probably null
R0894:Igf2r UTSW 17 12,910,988 (GRCm39) missense probably benign 0.02
R1265:Igf2r UTSW 17 12,913,011 (GRCm39) missense probably damaging 0.98
R1466:Igf2r UTSW 17 12,936,156 (GRCm39) splice site probably benign
R1485:Igf2r UTSW 17 12,910,172 (GRCm39) missense probably damaging 1.00
R1633:Igf2r UTSW 17 12,945,196 (GRCm39) missense probably benign
R1693:Igf2r UTSW 17 12,923,203 (GRCm39) missense probably damaging 0.97
R1751:Igf2r UTSW 17 12,916,328 (GRCm39) missense possibly damaging 0.94
R1843:Igf2r UTSW 17 12,923,157 (GRCm39) critical splice donor site probably null
R1981:Igf2r UTSW 17 12,952,790 (GRCm39) nonsense probably null
R1994:Igf2r UTSW 17 12,911,625 (GRCm39) missense probably benign
R2060:Igf2r UTSW 17 12,920,206 (GRCm39) missense possibly damaging 0.92
R2108:Igf2r UTSW 17 12,917,138 (GRCm39) missense probably benign 0.02
R2132:Igf2r UTSW 17 12,941,095 (GRCm39) missense probably benign 0.12
R2314:Igf2r UTSW 17 12,934,830 (GRCm39) missense probably benign 0.28
R2349:Igf2r UTSW 17 12,941,198 (GRCm39) splice site probably null
R2696:Igf2r UTSW 17 12,914,231 (GRCm39) missense possibly damaging 0.96
R2864:Igf2r UTSW 17 12,905,611 (GRCm39) missense probably damaging 0.99
R2865:Igf2r UTSW 17 12,905,611 (GRCm39) missense probably damaging 0.99
R3884:Igf2r UTSW 17 12,928,355 (GRCm39) missense probably benign
R3930:Igf2r UTSW 17 12,924,716 (GRCm39) missense probably benign 0.01
R4021:Igf2r UTSW 17 12,967,638 (GRCm39) missense probably damaging 0.97
R4125:Igf2r UTSW 17 12,921,141 (GRCm39) missense possibly damaging 0.93
R4342:Igf2r UTSW 17 12,928,398 (GRCm39) missense possibly damaging 0.95
R4343:Igf2r UTSW 17 12,928,398 (GRCm39) missense possibly damaging 0.95
R4345:Igf2r UTSW 17 12,928,398 (GRCm39) missense possibly damaging 0.95
R4760:Igf2r UTSW 17 12,922,352 (GRCm39) missense possibly damaging 0.92
R4796:Igf2r UTSW 17 12,903,013 (GRCm39) missense possibly damaging 0.70
R4816:Igf2r UTSW 17 12,902,984 (GRCm39) missense probably damaging 0.96
R4826:Igf2r UTSW 17 12,920,240 (GRCm39) missense probably damaging 0.98
R4933:Igf2r UTSW 17 12,910,764 (GRCm39) splice site probably null
R4980:Igf2r UTSW 17 12,922,247 (GRCm39) critical splice donor site probably null
R5389:Igf2r UTSW 17 12,944,303 (GRCm39) missense probably damaging 1.00
R5473:Igf2r UTSW 17 12,914,201 (GRCm39) missense probably benign 0.20
R5494:Igf2r UTSW 17 12,912,032 (GRCm39) missense possibly damaging 0.74
R5619:Igf2r UTSW 17 12,958,221 (GRCm39) missense probably damaging 1.00
R5738:Igf2r UTSW 17 12,936,254 (GRCm39) missense probably benign 0.23
R5761:Igf2r UTSW 17 12,917,239 (GRCm39) splice site probably null
R5794:Igf2r UTSW 17 12,928,332 (GRCm39) missense probably benign 0.37
R6319:Igf2r UTSW 17 12,933,000 (GRCm39) missense probably damaging 1.00
R6388:Igf2r UTSW 17 12,902,787 (GRCm39) missense probably benign
R6396:Igf2r UTSW 17 12,932,977 (GRCm39) missense probably benign 0.00
R6584:Igf2r UTSW 17 12,920,137 (GRCm39) missense probably damaging 0.99
R6590:Igf2r UTSW 17 12,910,824 (GRCm39) nonsense probably null
R6591:Igf2r UTSW 17 12,907,895 (GRCm39) missense probably damaging 1.00
R6599:Igf2r UTSW 17 12,917,505 (GRCm39) missense possibly damaging 0.85
R6690:Igf2r UTSW 17 12,910,824 (GRCm39) nonsense probably null
R6691:Igf2r UTSW 17 12,907,895 (GRCm39) missense probably damaging 1.00
R6752:Igf2r UTSW 17 12,933,831 (GRCm39) missense probably damaging 1.00
R6816:Igf2r UTSW 17 12,932,969 (GRCm39) missense probably damaging 0.99
R6841:Igf2r UTSW 17 12,922,263 (GRCm39) missense probably damaging 0.97
R6877:Igf2r UTSW 17 12,916,228 (GRCm39) missense probably damaging 0.97
R6950:Igf2r UTSW 17 12,937,605 (GRCm39) missense probably benign
R7030:Igf2r UTSW 17 12,952,753 (GRCm39) missense probably damaging 1.00
R7038:Igf2r UTSW 17 12,917,212 (GRCm39) missense probably benign 0.23
R7055:Igf2r UTSW 17 12,923,210 (GRCm39) missense probably damaging 0.99
R7074:Igf2r UTSW 17 12,933,003 (GRCm39) missense possibly damaging 0.57
R7348:Igf2r UTSW 17 12,922,371 (GRCm39) missense probably damaging 0.99
R7413:Igf2r UTSW 17 12,917,115 (GRCm39) nonsense probably null
R7463:Igf2r UTSW 17 12,929,532 (GRCm39) missense probably benign 0.16
R7619:Igf2r UTSW 17 12,917,160 (GRCm39) missense possibly damaging 0.88
R7730:Igf2r UTSW 17 12,954,878 (GRCm39) missense probably damaging 0.98
R7733:Igf2r UTSW 17 12,958,256 (GRCm39) missense possibly damaging 0.90
R7881:Igf2r UTSW 17 12,967,591 (GRCm39) missense probably benign
R8022:Igf2r UTSW 17 12,937,682 (GRCm39) missense probably damaging 1.00
R8138:Igf2r UTSW 17 12,920,125 (GRCm39) missense probably benign 0.32
R8220:Igf2r UTSW 17 12,910,958 (GRCm39) missense probably benign 0.22
R8305:Igf2r UTSW 17 12,952,747 (GRCm39) missense probably benign
R8359:Igf2r UTSW 17 12,902,748 (GRCm39) missense probably benign
R8500:Igf2r UTSW 17 12,928,328 (GRCm39) missense probably damaging 0.99
R8510:Igf2r UTSW 17 12,923,200 (GRCm39) missense probably benign 0.38
R8933:Igf2r UTSW 17 12,923,524 (GRCm39) missense probably damaging 1.00
R8933:Igf2r UTSW 17 12,920,131 (GRCm39) missense probably damaging 0.97
R8976:Igf2r UTSW 17 12,945,659 (GRCm39) missense probably damaging 1.00
R8994:Igf2r UTSW 17 12,935,537 (GRCm39) missense possibly damaging 0.87
R9059:Igf2r UTSW 17 12,970,180 (GRCm39) start codon destroyed probably null
R9097:Igf2r UTSW 17 12,910,100 (GRCm39) missense probably damaging 1.00
R9127:Igf2r UTSW 17 12,958,238 (GRCm39) missense probably damaging 0.98
R9278:Igf2r UTSW 17 12,914,240 (GRCm39) missense probably damaging 1.00
R9362:Igf2r UTSW 17 12,941,062 (GRCm39) missense probably benign 0.02
R9371:Igf2r UTSW 17 12,924,646 (GRCm39) missense possibly damaging 0.93
R9522:Igf2r UTSW 17 12,917,215 (GRCm39) missense probably benign 0.26
R9567:Igf2r UTSW 17 12,905,641 (GRCm39) missense probably damaging 1.00
R9665:Igf2r UTSW 17 12,913,027 (GRCm39) missense probably benign 0.17
R9666:Igf2r UTSW 17 12,945,588 (GRCm39) missense probably benign
X0028:Igf2r UTSW 17 12,923,800 (GRCm39) nonsense probably null
Z1177:Igf2r UTSW 17 12,916,286 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCAGGCCTGTTCTGATCAAG -3'
(R):5'- GTCCAAATGTTATGACATGTCCTG -3'

Sequencing Primer
(F):5'- GGCCTGTTCTGATCAAGAATTCCAG -3'
(R):5'- ATGACATGTCCTGTGAGTCATTC -3'
Posted On 2018-02-27