Incidental Mutation 'R6210:Vmn2r105'
ID503425
Institutional Source Beutler Lab
Gene Symbol Vmn2r105
Ensembl Gene ENSMUSG00000091670
Gene Namevomeronasal 2, receptor 105
SynonymsEG627743
MMRRC Submission 044344-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6210 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location20208230-20234872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20228496 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 140 (N140Y)
Ref Sequence ENSEMBL: ENSMUSP00000129762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167382]
Predicted Effect probably damaging
Transcript: ENSMUST00000167382
AA Change: N140Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129762
Gene: ENSMUSG00000091670
AA Change: N140Y

DomainStartEndE-ValueType
Pfam:ANF_receptor 85 469 6.5e-42 PFAM
Pfam:NCD3G 512 565 3.2e-21 PFAM
Pfam:7tm_3 598 833 2.5e-51 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T A 18: 10,706,032 I94F probably damaging Het
Bbox1 A T 2: 110,270,077 D258E probably benign Het
Catsperb A G 12: 101,412,568 probably null Het
Ccdc127 T C 13: 74,356,921 V196A probably benign Het
Cd101 A T 3: 101,018,643 D253E probably damaging Het
Ceacam15 T C 7: 16,673,289 Y101C probably damaging Het
Cep135 C T 5: 76,624,723 L652F probably benign Het
Col5a1 G T 2: 28,032,621 V234L probably benign Het
Cxcr6 T C 9: 123,810,008 S25P possibly damaging Het
D17Wsu92e A T 17: 27,767,986 D255E probably benign Het
Dctn4 C T 18: 60,546,793 Q258* probably null Het
Fmnl2 A T 2: 53,130,445 N1067I possibly damaging Het
Frrs1 A T 3: 116,878,431 K59N probably benign Het
Gpr157 T C 4: 150,101,598 Y206H probably damaging Het
Hephl1 A G 9: 15,090,564 Y161H possibly damaging Het
Hinfp C T 9: 44,298,872 probably null Het
Igf2r A T 17: 12,714,951 N805K probably damaging Het
Itga3 T C 11: 95,068,891 probably benign Het
Itga6 A G 2: 71,834,007 probably null Het
Kcnip1 G A 11: 33,645,600 T30I possibly damaging Het
Lig4 T C 8: 9,971,585 T732A probably benign Het
Lmod3 T A 6: 97,247,301 T520S probably damaging Het
Megf8 G A 7: 25,343,720 V1356I possibly damaging Het
Mical3 C T 6: 121,040,517 probably null Het
Msi1 T C 5: 115,435,476 I8T probably damaging Het
Mug4-ps A T 6: 121,950,317 noncoding transcript Het
Myo1f T A 17: 33,601,070 I783N probably damaging Het
Nr6a1 A C 2: 38,729,497 I462S probably damaging Het
Olfr1056 A G 2: 86,356,358 V8A probably benign Het
Olfr330 C T 11: 58,529,264 A241T probably damaging Het
Pah C A 10: 87,583,561 Q449K probably benign Het
Pced1a A G 2: 130,421,919 V271A probably damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Psg21 A G 7: 18,652,345 Y239H probably damaging Het
Ptprt T C 2: 162,268,029 Y180C probably damaging Het
Raet1d T A 10: 22,370,950 I59N probably damaging Het
Rfx1 T C 8: 84,093,018 L653P probably damaging Het
Rnase2a A G 14: 51,255,674 V78A possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Serbp1 T C 6: 67,272,867 probably benign Het
Tlr1 A T 5: 64,925,286 H649Q probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc6 T A 9: 8,656,730 D719E probably benign Het
Ttc21b A T 2: 66,236,354 S318R probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Uhmk1 T C 1: 170,212,237 Q187R probably damaging Het
Ung C T 5: 114,131,377 A50V probably benign Het
Upk3bl C T 5: 136,059,820 Q103* probably null Het
Usp17le C A 7: 104,769,143 C264F probably damaging Het
Vmn2r84 C T 10: 130,386,245 C702Y probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp748 G A 13: 67,540,804 P779L possibly damaging Het
Other mutations in Vmn2r105
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Vmn2r105 APN 17 20228555 missense probably benign 0.01
IGL01909:Vmn2r105 APN 17 20224656 missense probably damaging 1.00
IGL01925:Vmn2r105 APN 17 20208711 missense possibly damaging 0.94
IGL02021:Vmn2r105 APN 17 20227895 missense possibly damaging 0.49
IGL02828:Vmn2r105 APN 17 20209083 missense possibly damaging 0.80
IGL02838:Vmn2r105 APN 17 20227585 missense probably damaging 1.00
IGL03343:Vmn2r105 APN 17 20226369 nonsense probably null
R0096:Vmn2r105 UTSW 17 20227479 missense possibly damaging 0.49
R0096:Vmn2r105 UTSW 17 20227479 missense possibly damaging 0.49
R0212:Vmn2r105 UTSW 17 20208565 missense possibly damaging 0.90
R0268:Vmn2r105 UTSW 17 20208676 missense probably benign 0.18
R0271:Vmn2r105 UTSW 17 20234703 missense probably damaging 0.96
R0613:Vmn2r105 UTSW 17 20208316 missense probably damaging 1.00
R0765:Vmn2r105 UTSW 17 20227711 missense probably benign 0.20
R0765:Vmn2r105 UTSW 17 20227857 missense probably damaging 0.98
R1162:Vmn2r105 UTSW 17 20227711 missense probably benign 0.20
R1263:Vmn2r105 UTSW 17 20208322 missense probably damaging 1.00
R1363:Vmn2r105 UTSW 17 20208670 missense probably benign 0.00
R1464:Vmn2r105 UTSW 17 20228742 splice site probably benign
R2029:Vmn2r105 UTSW 17 20224578 missense probably damaging 0.99
R2420:Vmn2r105 UTSW 17 20227835 missense probably benign 0.15
R2421:Vmn2r105 UTSW 17 20227835 missense probably benign 0.15
R2422:Vmn2r105 UTSW 17 20227835 missense probably benign 0.15
R2570:Vmn2r105 UTSW 17 20227323 missense probably damaging 1.00
R3847:Vmn2r105 UTSW 17 20208690 missense possibly damaging 0.85
R3848:Vmn2r105 UTSW 17 20208690 missense possibly damaging 0.85
R4030:Vmn2r105 UTSW 17 20208754 missense probably damaging 0.99
R4275:Vmn2r105 UTSW 17 20228640 missense probably damaging 1.00
R4551:Vmn2r105 UTSW 17 20226351 missense probably benign
R4801:Vmn2r105 UTSW 17 20227294 missense probably benign 0.00
R4802:Vmn2r105 UTSW 17 20227294 missense probably benign 0.00
R4816:Vmn2r105 UTSW 17 20208691 missense probably benign 0.27
R4929:Vmn2r105 UTSW 17 20228018 missense probably benign 0.44
R5022:Vmn2r105 UTSW 17 20208414 missense probably damaging 0.99
R5475:Vmn2r105 UTSW 17 20234782 missense probably benign
R5576:Vmn2r105 UTSW 17 20224574 critical splice donor site probably null
R5795:Vmn2r105 UTSW 17 20228736 missense probably benign 0.00
R5895:Vmn2r105 UTSW 17 20228667 missense probably benign 0.10
R6017:Vmn2r105 UTSW 17 20208627 missense probably damaging 0.97
R6491:Vmn2r105 UTSW 17 20227730 nonsense probably null
R6542:Vmn2r105 UTSW 17 20228541 missense probably benign 0.03
R6729:Vmn2r105 UTSW 17 20208343 missense probably damaging 0.99
R7020:Vmn2r105 UTSW 17 20209074 missense probably damaging 1.00
R7033:Vmn2r105 UTSW 17 20208612 missense probably damaging 0.97
R7488:Vmn2r105 UTSW 17 20208783 missense probably damaging 1.00
R7491:Vmn2r105 UTSW 17 20228565 missense probably benign 0.02
R7555:Vmn2r105 UTSW 17 20227675 missense probably damaging 0.98
R7863:Vmn2r105 UTSW 17 20208675 missense probably benign 0.18
R8137:Vmn2r105 UTSW 17 20234704 missense probably benign 0.02
R8166:Vmn2r105 UTSW 17 20208642 missense probably benign 0.07
R8186:Vmn2r105 UTSW 17 20224618 nonsense probably null
R8214:Vmn2r105 UTSW 17 20228513 missense probably benign 0.02
R8497:Vmn2r105 UTSW 17 20234872 start codon destroyed probably null 0.75
R8850:Vmn2r105 UTSW 17 20208610 missense probably damaging 1.00
R8880:Vmn2r105 UTSW 17 20208967 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATGTGGATTGATCTCCTCGTG -3'
(R):5'- AAAGCTACCAGTATATTCTCGCTC -3'

Sequencing Primer
(F):5'- ATTGATCTCCTCGTGTTTGAGTC -3'
(R):5'- CTCTGCTATTTGCCATTGAGGAGATC -3'
Posted On2018-02-27