Incidental Mutation 'R6210:D17Wsu92e'
ID503426
Institutional Source Beutler Lab
Gene Symbol D17Wsu92e
Ensembl Gene ENSMUSG00000056692
Gene NameDNA segment, Chr 17, Wayne State University 92, expressed
Synonyms
MMRRC Submission 044344-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6210 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location27751232-27820558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27767986 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 255 (D255E)
Ref Sequence ENSEMBL: ENSMUSP00000074585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075076] [ENSMUST00000114859] [ENSMUST00000114863]
Predicted Effect probably benign
Transcript: ENSMUST00000075076
AA Change: D255E

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000074585
Gene: ENSMUSG00000056692
AA Change: D255E

DomainStartEndE-ValueType
Pfam:UBA_4 25 68 1.6e-13 PFAM
Pfam:N_BRCA1_IG 80 179 1.6e-37 PFAM
low complexity region 257 276 N/A INTRINSIC
low complexity region 282 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114859
SMART Domains Protein: ENSMUSP00000110509
Gene: ENSMUSG00000056692

DomainStartEndE-ValueType
Pfam:UBA_4 25 69 5.1e-15 PFAM
PDB:4OLE|D 74 180 2e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114863
AA Change: D255E

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000110513
Gene: ENSMUSG00000056692
AA Change: D255E

DomainStartEndE-ValueType
Pfam:UBA_4 25 69 2.2e-14 PFAM
PDB:4OLE|D 74 180 8e-9 PDB
low complexity region 257 276 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T A 18: 10,706,032 I94F probably damaging Het
Bbox1 A T 2: 110,270,077 D258E probably benign Het
Catsperb A G 12: 101,412,568 probably null Het
Ccdc127 T C 13: 74,356,921 V196A probably benign Het
Cd101 A T 3: 101,018,643 D253E probably damaging Het
Ceacam15 T C 7: 16,673,289 Y101C probably damaging Het
Cep135 C T 5: 76,624,723 L652F probably benign Het
Col5a1 G T 2: 28,032,621 V234L probably benign Het
Cxcr6 T C 9: 123,810,008 S25P possibly damaging Het
Dctn4 C T 18: 60,546,793 Q258* probably null Het
Fmnl2 A T 2: 53,130,445 N1067I possibly damaging Het
Frrs1 A T 3: 116,878,431 K59N probably benign Het
Gpr157 T C 4: 150,101,598 Y206H probably damaging Het
Hephl1 A G 9: 15,090,564 Y161H possibly damaging Het
Hinfp C T 9: 44,298,872 probably null Het
Igf2r A T 17: 12,714,951 N805K probably damaging Het
Itga3 T C 11: 95,068,891 probably benign Het
Itga6 A G 2: 71,834,007 probably null Het
Kcnip1 G A 11: 33,645,600 T30I possibly damaging Het
Lig4 T C 8: 9,971,585 T732A probably benign Het
Lmod3 T A 6: 97,247,301 T520S probably damaging Het
Megf8 G A 7: 25,343,720 V1356I possibly damaging Het
Mical3 C T 6: 121,040,517 probably null Het
Msi1 T C 5: 115,435,476 I8T probably damaging Het
Mug4-ps A T 6: 121,950,317 noncoding transcript Het
Myo1f T A 17: 33,601,070 I783N probably damaging Het
Nr6a1 A C 2: 38,729,497 I462S probably damaging Het
Olfr1056 A G 2: 86,356,358 V8A probably benign Het
Olfr330 C T 11: 58,529,264 A241T probably damaging Het
Pah C A 10: 87,583,561 Q449K probably benign Het
Pced1a A G 2: 130,421,919 V271A probably damaging Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Psg21 A G 7: 18,652,345 Y239H probably damaging Het
Ptprt T C 2: 162,268,029 Y180C probably damaging Het
Raet1d T A 10: 22,370,950 I59N probably damaging Het
Rfx1 T C 8: 84,093,018 L653P probably damaging Het
Rnase2a A G 14: 51,255,674 V78A possibly damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Serbp1 T C 6: 67,272,867 probably benign Het
Tlr1 A T 5: 64,925,286 H649Q probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc6 T A 9: 8,656,730 D719E probably benign Het
Ttc21b A T 2: 66,236,354 S318R probably benign Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Uhmk1 T C 1: 170,212,237 Q187R probably damaging Het
Ung C T 5: 114,131,377 A50V probably benign Het
Upk3bl C T 5: 136,059,820 Q103* probably null Het
Usp17le C A 7: 104,769,143 C264F probably damaging Het
Vmn2r105 T A 17: 20,228,496 N140Y probably damaging Het
Vmn2r84 C T 10: 130,386,245 C702Y probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp748 G A 13: 67,540,804 P779L possibly damaging Het
Other mutations in D17Wsu92e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:D17Wsu92e APN 17 27767919 missense probably damaging 1.00
IGL01107:D17Wsu92e APN 17 27786069 critical splice donor site probably null
IGL01805:D17Wsu92e APN 17 27767906 splice site probably benign
R0423:D17Wsu92e UTSW 17 27786233 missense probably damaging 1.00
R0833:D17Wsu92e UTSW 17 27786138 missense probably damaging 1.00
R0836:D17Wsu92e UTSW 17 27786138 missense probably damaging 1.00
R1055:D17Wsu92e UTSW 17 27767936 missense probably damaging 1.00
R1251:D17Wsu92e UTSW 17 27786070 critical splice donor site probably null
R1646:D17Wsu92e UTSW 17 27793960 missense probably damaging 1.00
R4022:D17Wsu92e UTSW 17 27786262 missense probably damaging 0.97
R4604:D17Wsu92e UTSW 17 27820315 missense probably damaging 1.00
R5360:D17Wsu92e UTSW 17 27794046 missense probably damaging 1.00
R7201:D17Wsu92e UTSW 17 27794070 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGCTGAGCAGTTAAGGAGCC -3'
(R):5'- CGCAGCAGCTGTCATCTTTTG -3'

Sequencing Primer
(F):5'- GCAGTTAAGGAGCCACAGC -3'
(R):5'- CAGCAGCTGTCATCTTTTGAAACG -3'
Posted On2018-02-27