Incidental Mutation 'R6211:Hdc'
ID 503436
Institutional Source Beutler Lab
Gene Symbol Hdc
Ensembl Gene ENSMUSG00000027360
Gene Name histidine decarboxylase
Synonyms Hdc-s, Hdc-a, Hdc-c, Hdc-e, L-histidine decarboxylase
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.751) question?
Stock # R6211 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 126593667-126619299 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 126593977 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 658 (L658Q)
Ref Sequence ENSEMBL: ENSMUSP00000028838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028838]
AlphaFold P23738
Predicted Effect probably damaging
Transcript: ENSMUST00000028838
AA Change: L658Q

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028838
Gene: ENSMUSG00000027360
AA Change: L658Q

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Pfam:Pyridoxal_deC 43 421 2.2e-173 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124396
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the group II decarboxylase family and forms a homodimer that converts L-histidine to histamine in a pyridoxal phosphate dependent manner. Histamine regulates several physiologic processes, including neurotransmission, gastric acid secretion,inflamation, and smooth muscle tone.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal mast cells, altered anxiety-related and nociceptive behavior, altered cognitive function, increased weight gain, visceral adiposity, increased amount of brown adipose tissue, impaired glucose tolerance, hyperinsulinemia, and hyperleptinemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,239,004 H1035Q possibly damaging Het
Acin1 A T 14: 54,644,046 W391R probably damaging Het
Arl6ip1 A T 7: 118,127,250 S18R probably benign Het
Armc3 G A 2: 19,296,803 probably null Het
Casc1 C T 6: 145,200,491 R95Q probably damaging Het
Ccdc162 G T 10: 41,630,145 S883* probably null Het
Cd300lg A G 11: 102,054,169 M358V possibly damaging Het
Cdh23 A G 10: 60,410,821 V949A possibly damaging Het
Cenpo C T 12: 4,216,733 S126N probably benign Het
Chd3 A T 11: 69,352,677 D1366E probably damaging Het
Chd4 A G 6: 125,101,285 E169G possibly damaging Het
Clec1b A G 6: 129,401,477 T24A possibly damaging Het
Clhc1 A G 11: 29,578,145 I558V probably damaging Het
Col5a2 T A 1: 45,376,666 R1440S probably damaging Het
Cops3 A G 11: 59,817,901 probably benign Het
Cxcr4 A G 1: 128,589,450 V158A probably damaging Het
Dnah7a A G 1: 53,419,636 M3781T probably damaging Het
Elovl5 C A 9: 77,981,502 T217K probably damaging Het
Fbln7 G T 2: 128,895,340 M358I probably damaging Het
Fbxl13 C T 5: 21,484,021 R763Q possibly damaging Het
Gabrr3 C A 16: 59,448,108 N361K probably benign Het
Gbp7 A G 3: 142,545,993 M534V probably benign Het
Hcar2 G A 5: 123,864,954 T162I probably benign Het
Hivep3 A G 4: 120,098,405 Y1306C probably damaging Het
Homer3 C T 8: 70,285,524 R49C probably damaging Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Iqgap3 A G 3: 88,091,515 N308D probably benign Het
Itga8 G A 2: 12,193,509 T555M probably damaging Het
Lrfn5 G T 12: 61,839,470 V15L probably benign Het
Lrrk1 T C 7: 66,302,710 K493E possibly damaging Het
Lyzl6 A G 11: 103,635,063 I77T probably damaging Het
Mavs G T 2: 131,240,391 R65L probably damaging Het
Mdn1 T G 4: 32,696,269 D1217E probably benign Het
Olfr103 A T 17: 37,336,708 F175I possibly damaging Het
Olfr1502 A G 19: 13,862,574 I260M probably benign Het
Olfr648 A T 7: 104,179,747 Y220* probably null Het
Otof C A 5: 30,371,900 V1762L probably damaging Het
Pcdha12 T C 18: 37,020,321 L31P probably damaging Het
Pxk C A 14: 8,163,952 P515T probably damaging Het
Qrich2 A T 11: 116,453,542 D1759E probably benign Het
Rps6ka1 A T 4: 133,869,306 F33Y probably damaging Het
Rxfp2 G A 5: 150,044,126 probably null Het
Slc23a4 A T 6: 34,956,961 I202N probably damaging Het
Slc24a5 A T 2: 125,088,251 I491F probably benign Het
Slco1a1 T A 6: 141,909,049 K625N probably benign Het
Snx31 A G 15: 36,546,885 V51A probably damaging Het
Sox6 G T 7: 115,801,462 H48Q probably damaging Het
Tas2r109 A T 6: 132,980,624 Y114* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Timm13 A C 10: 80,900,480 probably null Het
Tpsb2 G A 17: 25,367,763 A250T possibly damaging Het
Trpm6 T C 19: 18,783,128 I131T probably damaging Het
Vars2 A T 17: 35,665,662 probably null Het
Vmn2r35 T A 7: 7,786,528 I737F probably damaging Het
Wdr46 C A 17: 33,944,485 T339K probably damaging Het
Other mutations in Hdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Hdc APN 2 126601872 missense probably benign 0.00
IGL01024:Hdc APN 2 126603846 missense probably benign 0.32
IGL01393:Hdc APN 2 126594661 missense probably benign 0.28
IGL01802:Hdc APN 2 126603894 missense probably benign 0.04
IGL01958:Hdc APN 2 126594532 missense possibly damaging 0.87
IGL02193:Hdc APN 2 126601780 splice site probably benign
IGL02494:Hdc APN 2 126594121 missense probably benign
IGL02696:Hdc APN 2 126594300 missense probably damaging 1.00
IGL02874:Hdc APN 2 126601676 missense probably benign 0.21
R0453:Hdc UTSW 2 126594951 splice site probably benign
R0528:Hdc UTSW 2 126616232 missense probably benign 0.00
R1337:Hdc UTSW 2 126616276 missense probably benign
R1862:Hdc UTSW 2 126597933 missense probably benign 0.36
R1938:Hdc UTSW 2 126606397 missense possibly damaging 0.86
R1994:Hdc UTSW 2 126616187 missense probably damaging 1.00
R2230:Hdc UTSW 2 126594018 missense possibly damaging 0.65
R2257:Hdc UTSW 2 126616080 splice site probably null
R2921:Hdc UTSW 2 126593990 missense probably damaging 1.00
R2923:Hdc UTSW 2 126593990 missense probably damaging 1.00
R3620:Hdc UTSW 2 126616267 missense possibly damaging 0.86
R3621:Hdc UTSW 2 126616267 missense possibly damaging 0.86
R3914:Hdc UTSW 2 126603006 missense probably damaging 1.00
R4076:Hdc UTSW 2 126616261 missense possibly damaging 0.92
R4114:Hdc UTSW 2 126601818 missense probably benign 0.16
R4213:Hdc UTSW 2 126597866 splice site probably null
R4827:Hdc UTSW 2 126594313 missense probably benign
R4889:Hdc UTSW 2 126594133 missense probably benign 0.00
R5013:Hdc UTSW 2 126604300 missense probably benign 0.33
R5593:Hdc UTSW 2 126618584 utr 5 prime probably benign
R5604:Hdc UTSW 2 126594663 missense probably benign
R5637:Hdc UTSW 2 126616189 missense probably benign 0.02
R6312:Hdc UTSW 2 126607406 missense possibly damaging 0.65
R7730:Hdc UTSW 2 126594082 missense possibly damaging 0.51
R7889:Hdc UTSW 2 126616210 missense probably damaging 1.00
R8328:Hdc UTSW 2 126601883 missense probably damaging 1.00
R8482:Hdc UTSW 2 126594205 missense probably benign
R8517:Hdc UTSW 2 126597970 critical splice acceptor site probably null
R9136:Hdc UTSW 2 126597866 splice site probably null
R9139:Hdc UTSW 2 126597917 missense probably damaging 1.00
R9208:Hdc UTSW 2 126594680 missense probably benign 0.32
R9515:Hdc UTSW 2 126616229 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGCCCGCTTAAACTTCCCAG -3'
(R):5'- TATGAGTGCCCAGAAGTCACTC -3'

Sequencing Primer
(F):5'- ACAATCTGTTGTGGATCACGAAGAC -3'
(R):5'- GAAGTCACTCCCCGCAGACG -3'
Posted On 2018-02-27