Incidental Mutation 'R6211:Casc1'
ID 503454
Institutional Source Beutler Lab
Gene Symbol Casc1
Ensembl Gene ENSMUSG00000043541
Gene Name cancer susceptibility candidate 1
Synonyms A230084G12Rik, Las1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock # R6211 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 145174834-145211005 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 145200491 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 95 (R95Q)
Ref Sequence ENSEMBL: ENSMUSP00000144783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060797] [ENSMUST00000111728] [ENSMUST00000204105]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000060797
AA Change: R95Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000062279
Gene: ENSMUSG00000043541
AA Change: R95Q

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 5.5e-61 PFAM
Pfam:Casc1 241 469 3.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111727
Predicted Effect probably damaging
Transcript: ENSMUST00000111728
AA Change: R82Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107357
Gene: ENSMUSG00000043541
AA Change: R82Q

DomainStartEndE-ValueType
coiled coil region 1 45 N/A INTRINSIC
Pfam:Casc1 228 456 6.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152138
Predicted Effect probably damaging
Transcript: ENSMUST00000204105
AA Change: R95Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144783
Gene: ENSMUSG00000043541
AA Change: R95Q

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 3.4e-57 PFAM
Pfam:Casc1 241 469 2.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205162
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Mice with disruptions of this gene display a higher incidence of lung tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,239,004 H1035Q possibly damaging Het
Acin1 A T 14: 54,644,046 W391R probably damaging Het
Arl6ip1 A T 7: 118,127,250 S18R probably benign Het
Armc3 G A 2: 19,296,803 probably null Het
Ccdc162 G T 10: 41,630,145 S883* probably null Het
Cd300lg A G 11: 102,054,169 M358V possibly damaging Het
Cdh23 A G 10: 60,410,821 V949A possibly damaging Het
Cenpo C T 12: 4,216,733 S126N probably benign Het
Chd3 A T 11: 69,352,677 D1366E probably damaging Het
Chd4 A G 6: 125,101,285 E169G possibly damaging Het
Clec1b A G 6: 129,401,477 T24A possibly damaging Het
Clhc1 A G 11: 29,578,145 I558V probably damaging Het
Col5a2 T A 1: 45,376,666 R1440S probably damaging Het
Cops3 A G 11: 59,817,901 probably benign Het
Cxcr4 A G 1: 128,589,450 V158A probably damaging Het
Dnah7a A G 1: 53,419,636 M3781T probably damaging Het
Elovl5 C A 9: 77,981,502 T217K probably damaging Het
Fbln7 G T 2: 128,895,340 M358I probably damaging Het
Fbxl13 C T 5: 21,484,021 R763Q possibly damaging Het
Gabrr3 C A 16: 59,448,108 N361K probably benign Het
Gbp7 A G 3: 142,545,993 M534V probably benign Het
Hcar2 G A 5: 123,864,954 T162I probably benign Het
Hdc A T 2: 126,593,977 L658Q probably damaging Het
Hivep3 A G 4: 120,098,405 Y1306C probably damaging Het
Homer3 C T 8: 70,285,524 R49C probably damaging Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Iqgap3 A G 3: 88,091,515 N308D probably benign Het
Itga8 G A 2: 12,193,509 T555M probably damaging Het
Lrfn5 G T 12: 61,839,470 V15L probably benign Het
Lrrk1 T C 7: 66,302,710 K493E possibly damaging Het
Lyzl6 A G 11: 103,635,063 I77T probably damaging Het
Mavs G T 2: 131,240,391 R65L probably damaging Het
Mdn1 T G 4: 32,696,269 D1217E probably benign Het
Olfr103 A T 17: 37,336,708 F175I possibly damaging Het
Olfr1502 A G 19: 13,862,574 I260M probably benign Het
Olfr648 A T 7: 104,179,747 Y220* probably null Het
Otof C A 5: 30,371,900 V1762L probably damaging Het
Pcdha12 T C 18: 37,020,321 L31P probably damaging Het
Pxk C A 14: 8,163,952 P515T probably damaging Het
Qrich2 A T 11: 116,453,542 D1759E probably benign Het
Rps6ka1 A T 4: 133,869,306 F33Y probably damaging Het
Rxfp2 G A 5: 150,044,126 probably null Het
Slc23a4 A T 6: 34,956,961 I202N probably damaging Het
Slc24a5 A T 2: 125,088,251 I491F probably benign Het
Slco1a1 T A 6: 141,909,049 K625N probably benign Het
Snx31 A G 15: 36,546,885 V51A probably damaging Het
Sox6 G T 7: 115,801,462 H48Q probably damaging Het
Tas2r109 A T 6: 132,980,624 Y114* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Timm13 A C 10: 80,900,480 probably null Het
Tpsb2 G A 17: 25,367,763 A250T possibly damaging Het
Trpm6 T C 19: 18,783,128 I131T probably damaging Het
Vars2 A T 17: 35,665,662 probably null Het
Vmn2r35 T A 7: 7,786,528 I737F probably damaging Het
Wdr46 C A 17: 33,944,485 T339K probably damaging Het
Other mutations in Casc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Casc1 APN 6 145175290 missense probably benign 0.00
IGL00586:Casc1 APN 6 145191576 missense possibly damaging 0.53
IGL01066:Casc1 APN 6 145176222 missense probably damaging 0.96
IGL01413:Casc1 APN 6 145175086 missense probably damaging 1.00
IGL02275:Casc1 APN 6 145177364 missense probably damaging 1.00
IGL02668:Casc1 APN 6 145205257 missense unknown
IGL03018:Casc1 APN 6 145183305 missense probably damaging 1.00
IGL03233:Casc1 APN 6 145181885 missense probably damaging 1.00
R0011:Casc1 UTSW 6 145179055 missense probably damaging 1.00
R0011:Casc1 UTSW 6 145179055 missense probably damaging 1.00
R0180:Casc1 UTSW 6 145183218 critical splice donor site probably benign
R0786:Casc1 UTSW 6 145181757 critical splice donor site probably null
R1916:Casc1 UTSW 6 145176200 missense probably benign 0.37
R2117:Casc1 UTSW 6 145205241 critical splice donor site probably null
R2174:Casc1 UTSW 6 145175170 missense probably damaging 1.00
R2264:Casc1 UTSW 6 145208429 utr 5 prime probably benign
R4393:Casc1 UTSW 6 145194578 missense possibly damaging 0.49
R4467:Casc1 UTSW 6 145183218 critical splice donor site probably null
R4847:Casc1 UTSW 6 145175185 missense probably damaging 1.00
R5014:Casc1 UTSW 6 145183266 missense probably damaging 1.00
R5207:Casc1 UTSW 6 145179068 missense probably damaging 1.00
R5264:Casc1 UTSW 6 145181776 missense probably benign 0.02
R5359:Casc1 UTSW 6 145196892 missense probably damaging 1.00
R5499:Casc1 UTSW 6 145177431 missense probably damaging 1.00
R6579:Casc1 UTSW 6 145179018 missense probably benign 0.19
R6939:Casc1 UTSW 6 145175219 missense possibly damaging 0.46
R7108:Casc1 UTSW 6 145185865 nonsense probably null
R7131:Casc1 UTSW 6 145177406 missense probably null 0.97
R7810:Casc1 UTSW 6 145194586 missense probably benign 0.28
R8017:Casc1 UTSW 6 145194557 missense probably damaging 1.00
R8385:Casc1 UTSW 6 145175192 missense probably damaging 1.00
R8680:Casc1 UTSW 6 145181816 missense probably benign 0.13
R8720:Casc1 UTSW 6 145205257 missense unknown
R9118:Casc1 UTSW 6 145175174 missense probably damaging 1.00
R9118:Casc1 UTSW 6 145175245 missense probably damaging 1.00
R9172:Casc1 UTSW 6 145177449 missense probably benign
R9290:Casc1 UTSW 6 145202962 missense unknown
X0063:Casc1 UTSW 6 145175271 missense probably benign 0.13
Z1176:Casc1 UTSW 6 145205293 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGTCATGTATGTGCCAAATGAGG -3'
(R):5'- ACTGTTTCAGTCAGCATTAGCAG -3'

Sequencing Primer
(F):5'- AACTGGTGGTAACTGTAGTAACTG -3'
(R):5'- TCAGTCAGCATTAGCAGTTTTATTC -3'
Posted On 2018-02-27