Mutagenetix > Incidental Mutation

Incidental Mutation 'R6211:Casc1'

503454

Institutional Source

Beutler Lab

Gene Symbol

Casc1

Ensembl Gene

ENSMUSG00000043541

Gene Name

cancer susceptibility candidate 1

Synonyms

A230084G12Rik, Las1

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.054) question?

Stock #

R6211 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

145174834-145211005 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 145200491 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 95 (R95Q)

Ref Sequence

ENSEMBL: ENSMUSP00000144783 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060797] [ENSMUST00000111728] [ENSMUST00000204105]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000060797
AA Change: R95Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000062279
Gene: ENSMUSG00000043541
AA Change: R95Q

Domain	Start	End	E-Value	Type
low complexity region	1	14	N/A	INTRINSIC
Pfam:Casc1_N	29	229	5.5e-61	PFAM
Pfam:Casc1	241	469	3.4e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000111727

Predicted Effect

probably damaging
Transcript: ENSMUST00000111728
AA Change: R82Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000107357
Gene: ENSMUSG00000043541
AA Change: R82Q

Domain	Start	End	E-Value	Type
coiled coil region	1	45	N/A	INTRINSIC
Pfam:Casc1	228	456	6.1e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128070

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133671

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152138

Predicted Effect

probably damaging
Transcript: ENSMUST00000204105
AA Change: R95Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000144783
Gene: ENSMUSG00000043541
AA Change: R95Q

Domain	Start	End	E-Value	Type
low complexity region	1	14	N/A	INTRINSIC
Pfam:Casc1_N	29	229	3.4e-57	PFAM
Pfam:Casc1	241	469	2.3e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205162

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.6%

Validation Efficiency

100% (54/54)

MGI Phenotype

PHENOTYPE: Mice with disruptions of this gene display a higher incidence of lung tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	T	7: 34,239,004	H1035Q	possibly damaging	Het
Acin1	A	T	14: 54,644,046	W391R	probably damaging	Het
Arl6ip1	A	T	7: 118,127,250	S18R	probably benign	Het
Armc3	G	A	2: 19,296,803		probably null	Het
Ccdc162	G	T	10: 41,630,145	S883*	probably null	Het
Cd300lg	A	G	11: 102,054,169	M358V	possibly damaging	Het
Cdh23	A	G	10: 60,410,821	V949A	possibly damaging	Het
Cenpo	C	T	12: 4,216,733	S126N	probably benign	Het
Chd3	A	T	11: 69,352,677	D1366E	probably damaging	Het
Chd4	A	G	6: 125,101,285	E169G	possibly damaging	Het
Clec1b	A	G	6: 129,401,477	T24A	possibly damaging	Het
Clhc1	A	G	11: 29,578,145	I558V	probably damaging	Het
Col5a2	T	A	1: 45,376,666	R1440S	probably damaging	Het
Cops3	A	G	11: 59,817,901		probably benign	Het
Cxcr4	A	G	1: 128,589,450	V158A	probably damaging	Het
Dnah7a	A	G	1: 53,419,636	M3781T	probably damaging	Het
Elovl5	C	A	9: 77,981,502	T217K	probably damaging	Het
Fbln7	G	T	2: 128,895,340	M358I	probably damaging	Het
Fbxl13	C	T	5: 21,484,021	R763Q	possibly damaging	Het
Gabrr3	C	A	16: 59,448,108	N361K	probably benign	Het
Gbp7	A	G	3: 142,545,993	M534V	probably benign	Het
Hcar2	G	A	5: 123,864,954	T162I	probably benign	Het
Hdc	A	T	2: 126,593,977	L658Q	probably damaging	Het
Hivep3	A	G	4: 120,098,405	Y1306C	probably damaging	Het
Homer3	C	T	8: 70,285,524	R49C	probably damaging	Het
Hspa4	C	T	11: 53,262,939	E702K	probably benign	Het
Iqgap3	A	G	3: 88,091,515	N308D	probably benign	Het
Itga8	G	A	2: 12,193,509	T555M	probably damaging	Het
Lrfn5	G	T	12: 61,839,470	V15L	probably benign	Het
Lrrk1	T	C	7: 66,302,710	K493E	possibly damaging	Het
Lyzl6	A	G	11: 103,635,063	I77T	probably damaging	Het
Mavs	G	T	2: 131,240,391	R65L	probably damaging	Het
Mdn1	T	G	4: 32,696,269	D1217E	probably benign	Het
Olfr103	A	T	17: 37,336,708	F175I	possibly damaging	Het
Olfr1502	A	G	19: 13,862,574	I260M	probably benign	Het
Olfr648	A	T	7: 104,179,747	Y220*	probably null	Het
Otof	C	A	5: 30,371,900	V1762L	probably damaging	Het
Pcdha12	T	C	18: 37,020,321	L31P	probably damaging	Het
Pxk	C	A	14: 8,163,952	P515T	probably damaging	Het
Qrich2	A	T	11: 116,453,542	D1759E	probably benign	Het
Rps6ka1	A	T	4: 133,869,306	F33Y	probably damaging	Het
Rxfp2	G	A	5: 150,044,126		probably null	Het
Slc23a4	A	T	6: 34,956,961	I202N	probably damaging	Het
Slc24a5	A	T	2: 125,088,251	I491F	probably benign	Het
Slco1a1	T	A	6: 141,909,049	K625N	probably benign	Het
Snx31	A	G	15: 36,546,885	V51A	probably damaging	Het
Sox6	G	T	7: 115,801,462	H48Q	probably damaging	Het
Tas2r109	A	T	6: 132,980,624	Y114*	probably null	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Timm13	A	C	10: 80,900,480		probably null	Het
Tpsb2	G	A	17: 25,367,763	A250T	possibly damaging	Het
Trpm6	T	C	19: 18,783,128	I131T	probably damaging	Het
Vars2	A	T	17: 35,665,662		probably null	Het
Vmn2r35	T	A	7: 7,786,528	I737F	probably damaging	Het
Wdr46	C	A	17: 33,944,485	T339K	probably damaging	Het

Other mutations in Casc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Casc1	APN	6	145175290	missense	probably benign	0.00
IGL00586:Casc1	APN	6	145191576	missense	possibly damaging	0.53
IGL01066:Casc1	APN	6	145176222	missense	probably damaging	0.96
IGL01413:Casc1	APN	6	145175086	missense	probably damaging	1.00
IGL02275:Casc1	APN	6	145177364	missense	probably damaging	1.00
IGL02668:Casc1	APN	6	145205257	missense	unknown
IGL03018:Casc1	APN	6	145183305	missense	probably damaging	1.00
IGL03233:Casc1	APN	6	145181885	missense	probably damaging	1.00
R0011:Casc1	UTSW	6	145179055	missense	probably damaging	1.00
R0011:Casc1	UTSW	6	145179055	missense	probably damaging	1.00
R0180:Casc1	UTSW	6	145183218	critical splice donor site	probably benign
R0786:Casc1	UTSW	6	145181757	critical splice donor site	probably null
R1916:Casc1	UTSW	6	145176200	missense	probably benign	0.37
R2117:Casc1	UTSW	6	145205241	critical splice donor site	probably null
R2174:Casc1	UTSW	6	145175170	missense	probably damaging	1.00
R2264:Casc1	UTSW	6	145208429	utr 5 prime	probably benign
R4393:Casc1	UTSW	6	145194578	missense	possibly damaging	0.49
R4467:Casc1	UTSW	6	145183218	critical splice donor site	probably null
R4847:Casc1	UTSW	6	145175185	missense	probably damaging	1.00
R5014:Casc1	UTSW	6	145183266	missense	probably damaging	1.00
R5207:Casc1	UTSW	6	145179068	missense	probably damaging	1.00
R5264:Casc1	UTSW	6	145181776	missense	probably benign	0.02
R5359:Casc1	UTSW	6	145196892	missense	probably damaging	1.00
R5499:Casc1	UTSW	6	145177431	missense	probably damaging	1.00
R6579:Casc1	UTSW	6	145179018	missense	probably benign	0.19
R6939:Casc1	UTSW	6	145175219	missense	possibly damaging	0.46
R7108:Casc1	UTSW	6	145185865	nonsense	probably null
R7131:Casc1	UTSW	6	145177406	missense	probably null	0.97
R7810:Casc1	UTSW	6	145194586	missense	probably benign	0.28
R8017:Casc1	UTSW	6	145194557	missense	probably damaging	1.00
R8385:Casc1	UTSW	6	145175192	missense	probably damaging	1.00
R8680:Casc1	UTSW	6	145181816	missense	probably benign	0.13
R8720:Casc1	UTSW	6	145205257	missense	unknown
R9118:Casc1	UTSW	6	145175174	missense	probably damaging	1.00
R9118:Casc1	UTSW	6	145175245	missense	probably damaging	1.00
R9172:Casc1	UTSW	6	145177449	missense	probably benign
R9290:Casc1	UTSW	6	145202962	missense	unknown
X0063:Casc1	UTSW	6	145175271	missense	probably benign	0.13
Z1176:Casc1	UTSW	6	145205293	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTGTCATGTATGTGCCAAATGAGG -3'
(R):5'- ACTGTTTCAGTCAGCATTAGCAG -3'

Sequencing Primer
(F):5'- AACTGGTGGTAACTGTAGTAACTG -3'
(R):5'- TCAGTCAGCATTAGCAGTTTTATTC -3'

Posted On

2018-02-27