Incidental Mutation 'R6211:Vmn2r35'
ID503455
Institutional Source Beutler Lab
Gene Symbol Vmn2r35
Ensembl Gene ENSMUSG00000096399
Gene Namevomeronasal 2, receptor 35
SynonymsEG625353
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6211 (G1)
Quality Score127.008
Status Not validated
Chromosome7
Chromosomal Location7786151-7819867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7786528 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 737 (I737F)
Ref Sequence ENSEMBL: ENSMUSP00000133007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169683]
Predicted Effect probably damaging
Transcript: ENSMUST00000169683
AA Change: I737F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133007
Gene: ENSMUSG00000096399
AA Change: I737F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 1.8e-32 PFAM
Pfam:NCD3G 512 565 1.2e-18 PFAM
Pfam:7tm_3 595 833 2.4e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,239,004 H1035Q possibly damaging Het
Acin1 A T 14: 54,644,046 W391R probably damaging Het
Arl6ip1 A T 7: 118,127,250 S18R probably benign Het
Armc3 G A 2: 19,296,803 probably null Het
Casc1 C T 6: 145,200,491 R95Q probably damaging Het
Ccdc162 G T 10: 41,630,145 S883* probably null Het
Cd300lg A G 11: 102,054,169 M358V possibly damaging Het
Cdh23 A G 10: 60,410,821 V949A possibly damaging Het
Cenpo C T 12: 4,216,733 S126N probably benign Het
Chd3 A T 11: 69,352,677 D1366E probably damaging Het
Chd4 A G 6: 125,101,285 E169G possibly damaging Het
Clec1b A G 6: 129,401,477 T24A possibly damaging Het
Clhc1 A G 11: 29,578,145 I558V probably damaging Het
Col5a2 T A 1: 45,376,666 R1440S probably damaging Het
Cops3 A G 11: 59,817,901 probably benign Het
Cxcr4 A G 1: 128,589,450 V158A probably damaging Het
Dnah7a A G 1: 53,419,636 M3781T probably damaging Het
Elovl5 C A 9: 77,981,502 T217K probably damaging Het
Fbln7 G T 2: 128,895,340 M358I probably damaging Het
Fbxl13 C T 5: 21,484,021 R763Q possibly damaging Het
Gabrr3 C A 16: 59,448,108 N361K probably benign Het
Gbp7 A G 3: 142,545,993 M534V probably benign Het
Hcar2 G A 5: 123,864,954 T162I probably benign Het
Hdc A T 2: 126,593,977 L658Q probably damaging Het
Hivep3 A G 4: 120,098,405 Y1306C probably damaging Het
Homer3 C T 8: 70,285,524 R49C probably damaging Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Iqgap3 A G 3: 88,091,515 N308D probably benign Het
Itga8 G A 2: 12,193,509 T555M probably damaging Het
Lrfn5 G T 12: 61,839,470 V15L probably benign Het
Lrrk1 T C 7: 66,302,710 K493E possibly damaging Het
Lyzl6 A G 11: 103,635,063 I77T probably damaging Het
Mavs G T 2: 131,240,391 R65L probably damaging Het
Mdn1 T G 4: 32,696,269 D1217E probably benign Het
Olfr103 A T 17: 37,336,708 F175I possibly damaging Het
Olfr1502 A G 19: 13,862,574 I260M probably benign Het
Olfr648 A T 7: 104,179,747 Y220* probably null Het
Otof C A 5: 30,371,900 V1762L probably damaging Het
Pcdha12 T C 18: 37,020,321 L31P probably damaging Het
Pxk C A 14: 8,163,952 P515T probably damaging Het
Qrich2 A T 11: 116,453,542 D1759E probably benign Het
Rps6ka1 A T 4: 133,869,306 F33Y probably damaging Het
Rxfp2 G A 5: 150,044,126 probably null Het
Slc23a4 A T 6: 34,956,961 I202N probably damaging Het
Slc24a5 A T 2: 125,088,251 I491F probably benign Het
Slco1a1 T A 6: 141,909,049 K625N probably benign Het
Snx31 A G 15: 36,546,885 V51A probably damaging Het
Sox6 G T 7: 115,801,462 H48Q probably damaging Het
Tas2r109 A T 6: 132,980,624 Y114* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Timm13 A C 10: 80,900,480 probably null Het
Tpsb2 G A 17: 25,367,763 A250T possibly damaging Het
Trpm6 T C 19: 18,783,128 I131T probably damaging Het
Vars2 A T 17: 35,665,662 probably null Het
Wdr46 C A 17: 33,944,485 T339K probably damaging Het
Other mutations in Vmn2r35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01875:Vmn2r35 APN 7 7816773 splice site probably benign
IGL03334:Vmn2r35 APN 7 7786494 missense probably damaging 1.00
R1858:Vmn2r35 UTSW 7 7816806 missense possibly damaging 0.46
R5505:Vmn2r35 UTSW 7 7786480 missense probably damaging 1.00
R6150:Vmn2r35 UTSW 7 7786556 missense probably damaging 1.00
R7439:Vmn2r35 UTSW 7 7817014 missense probably damaging 1.00
R8399:Vmn2r35 UTSW 7 7816898 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTTGGTGCTATGGTAGACAGG -3'
(R):5'- GGCTAAAACAGTCACTGTGGTTC -3'

Sequencing Primer
(F):5'- GGAGGAAGGTGACCCAGACAC -3'
(R):5'- GTGGTTCTCGCCTTCAAAATCACAG -3'
Posted On2018-02-27