Incidental Mutation 'R6211:Garre1'
ID 503456
Institutional Source Beutler Lab
Gene Symbol Garre1
Ensembl Gene ENSMUSG00000066571
Gene Name granule associated Rac and RHOG effector 1
Synonyms 4931406P16Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6211 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 33936132-34012976 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 33938429 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 1035 (H1035Q)
Ref Sequence ENSEMBL: ENSMUSP00000103709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085592] [ENSMUST00000108074] [ENSMUST00000205264] [ENSMUST00000206399]
AlphaFold Q8C5X1
Predicted Effect possibly damaging
Transcript: ENSMUST00000085592
AA Change: H1035Q

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082730
Gene: ENSMUSG00000066571
AA Change: H1035Q

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Pfam:DUF4745 59 187 1.3e-57 PFAM
low complexity region 319 332 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
low complexity region 677 696 N/A INTRINSIC
low complexity region 699 729 N/A INTRINSIC
low complexity region 771 786 N/A INTRINSIC
low complexity region 856 868 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 940 951 N/A INTRINSIC
low complexity region 1026 1049 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108074
AA Change: H1035Q

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103709
Gene: ENSMUSG00000066571
AA Change: H1035Q

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
low complexity region 677 696 N/A INTRINSIC
low complexity region 699 729 N/A INTRINSIC
low complexity region 771 786 N/A INTRINSIC
low complexity region 856 868 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 940 951 N/A INTRINSIC
low complexity region 1026 1049 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140881
Predicted Effect probably benign
Transcript: ENSMUST00000205264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206245
Predicted Effect possibly damaging
Transcript: ENSMUST00000206399
AA Change: H823Q

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 A T 14: 54,881,503 (GRCm39) W391R probably damaging Het
Arl6ip1 A T 7: 117,726,473 (GRCm39) S18R probably benign Het
Armc3 G A 2: 19,301,614 (GRCm39) probably null Het
Ccdc162 G T 10: 41,506,141 (GRCm39) S883* probably null Het
Cd300lg A G 11: 101,944,995 (GRCm39) M358V possibly damaging Het
Cdh23 A G 10: 60,246,600 (GRCm39) V949A possibly damaging Het
Cenpo C T 12: 4,266,733 (GRCm39) S126N probably benign Het
Chd3 A T 11: 69,243,503 (GRCm39) D1366E probably damaging Het
Chd4 A G 6: 125,078,248 (GRCm39) E169G possibly damaging Het
Clec1b A G 6: 129,378,440 (GRCm39) T24A possibly damaging Het
Clhc1 A G 11: 29,528,145 (GRCm39) I558V probably damaging Het
Col5a2 T A 1: 45,415,826 (GRCm39) R1440S probably damaging Het
Cops3 A G 11: 59,708,727 (GRCm39) probably benign Het
Cxcr4 A G 1: 128,517,187 (GRCm39) V158A probably damaging Het
Dnah7a A G 1: 53,458,795 (GRCm39) M3781T probably damaging Het
Dnai7 C T 6: 145,146,217 (GRCm39) R95Q probably damaging Het
Elovl5 C A 9: 77,888,784 (GRCm39) T217K probably damaging Het
Fbln7 G T 2: 128,737,260 (GRCm39) M358I probably damaging Het
Fbxl13 C T 5: 21,689,019 (GRCm39) R763Q possibly damaging Het
Gabrr3 C A 16: 59,268,471 (GRCm39) N361K probably benign Het
Gbp7 A G 3: 142,251,754 (GRCm39) M534V probably benign Het
Hcar2 G A 5: 124,003,017 (GRCm39) T162I probably benign Het
Hdc A T 2: 126,435,897 (GRCm39) L658Q probably damaging Het
Hivep3 A G 4: 119,955,602 (GRCm39) Y1306C probably damaging Het
Homer3 C T 8: 70,738,174 (GRCm39) R49C probably damaging Het
Hspa4 C T 11: 53,153,766 (GRCm39) E702K probably benign Het
Iqgap3 A G 3: 87,998,822 (GRCm39) N308D probably benign Het
Itga8 G A 2: 12,198,320 (GRCm39) T555M probably damaging Het
Lrfn5 G T 12: 61,886,256 (GRCm39) V15L probably benign Het
Lrrk1 T C 7: 65,952,458 (GRCm39) K493E possibly damaging Het
Lyzl6 A G 11: 103,525,889 (GRCm39) I77T probably damaging Het
Mavs G T 2: 131,082,311 (GRCm39) R65L probably damaging Het
Mdn1 T G 4: 32,696,269 (GRCm39) D1217E probably benign Het
Or12d13 A T 17: 37,647,599 (GRCm39) F175I possibly damaging Het
Or52h1 A T 7: 103,828,954 (GRCm39) Y220* probably null Het
Or9i1 A G 19: 13,839,938 (GRCm39) I260M probably benign Het
Otof C A 5: 30,529,244 (GRCm39) V1762L probably damaging Het
Pcdha12 T C 18: 37,153,374 (GRCm39) L31P probably damaging Het
Pxk C A 14: 8,163,952 (GRCm38) P515T probably damaging Het
Qrich2 A T 11: 116,344,368 (GRCm39) D1759E probably benign Het
Rps6ka1 A T 4: 133,596,617 (GRCm39) F33Y probably damaging Het
Rxfp2 G A 5: 149,967,591 (GRCm39) probably null Het
Slc23a4 A T 6: 34,933,896 (GRCm39) I202N probably damaging Het
Slc24a5 A T 2: 124,930,171 (GRCm39) I491F probably benign Het
Slco1a1 T A 6: 141,854,775 (GRCm39) K625N probably benign Het
Snx31 A G 15: 36,547,030 (GRCm39) V51A probably damaging Het
Sox6 G T 7: 115,400,697 (GRCm39) H48Q probably damaging Het
Tas2r109 A T 6: 132,957,587 (GRCm39) Y114* probably null Het
Tbc1d2 C T 4: 46,629,912 (GRCm39) G252R probably benign Het
Timm13 A C 10: 80,736,314 (GRCm39) probably null Het
Tpsb2 G A 17: 25,586,737 (GRCm39) A250T possibly damaging Het
Trpm6 T C 19: 18,760,492 (GRCm39) I131T probably damaging Het
Vars2 A T 17: 35,976,554 (GRCm39) probably null Het
Vmn2r35 T A 7: 7,789,527 (GRCm39) I737F probably damaging Het
Wdr46 C A 17: 34,163,459 (GRCm39) T339K probably damaging Het
Other mutations in Garre1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Garre1 APN 7 33,945,412 (GRCm39) splice site probably benign
IGL00160:Garre1 APN 7 33,938,431 (GRCm39) missense possibly damaging 0.88
IGL00691:Garre1 APN 7 33,944,910 (GRCm39) missense probably damaging 1.00
IGL01312:Garre1 APN 7 33,955,933 (GRCm39) missense probably benign 0.19
IGL01954:Garre1 APN 7 33,944,460 (GRCm39) missense probably damaging 1.00
IGL02016:Garre1 APN 7 33,938,526 (GRCm39) missense possibly damaging 0.74
IGL02390:Garre1 APN 7 33,947,643 (GRCm39) missense probably damaging 1.00
IGL02407:Garre1 APN 7 33,955,909 (GRCm39) missense probably damaging 0.99
IGL02677:Garre1 APN 7 33,941,834 (GRCm39) splice site probably benign
IGL02929:Garre1 APN 7 33,944,507 (GRCm39) missense possibly damaging 0.46
IGL03285:Garre1 APN 7 33,984,416 (GRCm39) missense possibly damaging 0.81
I1329:Garre1 UTSW 7 33,944,619 (GRCm39) missense probably benign 0.00
R0004:Garre1 UTSW 7 33,955,853 (GRCm39) missense probably damaging 0.99
R0100:Garre1 UTSW 7 33,953,436 (GRCm39) missense possibly damaging 0.95
R0100:Garre1 UTSW 7 33,953,436 (GRCm39) missense possibly damaging 0.95
R0135:Garre1 UTSW 7 33,945,382 (GRCm39) missense probably damaging 1.00
R0137:Garre1 UTSW 7 33,938,644 (GRCm39) missense probably damaging 1.00
R0556:Garre1 UTSW 7 33,939,222 (GRCm39) missense probably damaging 0.99
R0687:Garre1 UTSW 7 33,944,843 (GRCm39) missense possibly damaging 0.95
R0928:Garre1 UTSW 7 33,947,671 (GRCm39) splice site probably null
R1719:Garre1 UTSW 7 33,947,631 (GRCm39) missense probably damaging 0.98
R1908:Garre1 UTSW 7 33,957,461 (GRCm39) missense probably benign 0.14
R1909:Garre1 UTSW 7 33,957,461 (GRCm39) missense probably benign 0.14
R1976:Garre1 UTSW 7 33,956,805 (GRCm39) missense probably damaging 0.99
R2496:Garre1 UTSW 7 33,955,916 (GRCm39) missense possibly damaging 0.93
R3005:Garre1 UTSW 7 33,984,209 (GRCm39) missense probably damaging 1.00
R4666:Garre1 UTSW 7 33,984,198 (GRCm39) missense probably damaging 0.98
R4832:Garre1 UTSW 7 33,938,333 (GRCm39) utr 3 prime probably benign
R4870:Garre1 UTSW 7 33,984,312 (GRCm39) missense possibly damaging 0.83
R4989:Garre1 UTSW 7 33,945,225 (GRCm39) missense probably damaging 1.00
R5033:Garre1 UTSW 7 33,945,237 (GRCm39) missense probably benign
R5308:Garre1 UTSW 7 33,945,180 (GRCm39) nonsense probably null
R5366:Garre1 UTSW 7 33,941,713 (GRCm39) missense possibly damaging 0.74
R5386:Garre1 UTSW 7 33,941,813 (GRCm39) missense probably damaging 0.99
R5688:Garre1 UTSW 7 33,984,134 (GRCm39) missense probably damaging 0.99
R5688:Garre1 UTSW 7 33,953,416 (GRCm39) missense possibly damaging 0.74
R5714:Garre1 UTSW 7 33,939,941 (GRCm39) nonsense probably null
R5733:Garre1 UTSW 7 33,944,505 (GRCm39) missense probably damaging 0.99
R5772:Garre1 UTSW 7 33,953,413 (GRCm39) missense probably damaging 0.97
R6059:Garre1 UTSW 7 33,944,888 (GRCm39) missense possibly damaging 0.90
R6276:Garre1 UTSW 7 33,941,802 (GRCm39) nonsense probably null
R6477:Garre1 UTSW 7 33,957,055 (GRCm39) critical splice donor site probably null
R6757:Garre1 UTSW 7 33,938,502 (GRCm39) missense possibly damaging 0.89
R6912:Garre1 UTSW 7 33,945,093 (GRCm39) missense probably benign
R7156:Garre1 UTSW 7 33,945,133 (GRCm39) missense possibly damaging 0.80
R7317:Garre1 UTSW 7 33,963,072 (GRCm39) missense probably benign
R7431:Garre1 UTSW 7 33,984,219 (GRCm39) missense possibly damaging 0.73
R7452:Garre1 UTSW 7 33,945,096 (GRCm39) missense probably benign
R7996:Garre1 UTSW 7 33,963,024 (GRCm39) missense possibly damaging 0.77
R8348:Garre1 UTSW 7 33,984,569 (GRCm39) missense probably damaging 1.00
R8448:Garre1 UTSW 7 33,984,569 (GRCm39) missense probably damaging 1.00
R8989:Garre1 UTSW 7 33,956,869 (GRCm39) missense probably damaging 0.99
R9010:Garre1 UTSW 7 33,938,491 (GRCm39) missense probably benign 0.01
R9095:Garre1 UTSW 7 33,956,770 (GRCm39) critical splice donor site probably null
R9505:Garre1 UTSW 7 33,984,371 (GRCm39) missense probably damaging 1.00
R9530:Garre1 UTSW 7 33,963,069 (GRCm39) missense probably benign 0.01
R9612:Garre1 UTSW 7 33,947,656 (GRCm39) missense probably damaging 1.00
RF019:Garre1 UTSW 7 33,939,974 (GRCm39) missense probably damaging 0.98
X0021:Garre1 UTSW 7 33,944,788 (GRCm39) missense possibly damaging 0.94
Z1177:Garre1 UTSW 7 33,984,180 (GRCm39) missense probably damaging 0.96
Z1186:Garre1 UTSW 7 33,945,185 (GRCm39) missense probably benign
Z1186:Garre1 UTSW 7 33,938,583 (GRCm39) missense probably benign 0.03
Z1186:Garre1 UTSW 7 33,938,533 (GRCm39) missense probably benign
Z1191:Garre1 UTSW 7 33,945,185 (GRCm39) missense probably benign
Z1191:Garre1 UTSW 7 33,938,583 (GRCm39) missense probably benign 0.03
Z1191:Garre1 UTSW 7 33,938,533 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGGGTGTACTGGTCCTTC -3'
(R):5'- TCTTCTGTTTCCCAGGATAACAAAACC -3'

Sequencing Primer
(F):5'- CCTTCTGGGGGCTAGTATCAGC -3'
(R):5'- ATGGCAGCACCCTTCCC -3'
Posted On 2018-02-27