Incidental Mutation 'R6211:Elovl5'
ID503462
Institutional Source Beutler Lab
Gene Symbol Elovl5
Ensembl Gene ENSMUSG00000032349
Gene NameELOVL family member 5, elongation of long chain fatty acids (yeast)
Synonyms1110059L23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6211 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location77917364-77984519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 77981502 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 217 (T217K)
Ref Sequence ENSEMBL: ENSMUSP00000034904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034904] [ENSMUST00000133757]
Predicted Effect probably damaging
Transcript: ENSMUST00000034904
AA Change: T217K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034904
Gene: ENSMUSG00000032349
AA Change: T217K

DomainStartEndE-ValueType
Pfam:ELO 27 262 2.3e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133757
SMART Domains Protein: ENSMUSP00000123121
Gene: ENSMUSG00000032349

DomainStartEndE-ValueType
Pfam:ELO 27 180 4.6e-46 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ELO family. It is highly expressed in the adrenal gland and testis, and encodes a multi-pass membrane protein that is localized in the endoplasmic reticulum. This protein is involved in the elongation of long-chain polyunsaturated fatty acids. Mutations in this gene have been associated with spinocerebellar ataxia-38 (SCA38). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele have defects in fatty acid synthesis in the liver that result in hepatic steatosis. Also, majority of female mice have defects in female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,239,004 H1035Q possibly damaging Het
Acin1 A T 14: 54,644,046 W391R probably damaging Het
Arl6ip1 A T 7: 118,127,250 S18R probably benign Het
Armc3 G A 2: 19,296,803 probably null Het
Casc1 C T 6: 145,200,491 R95Q probably damaging Het
Ccdc162 G T 10: 41,630,145 S883* probably null Het
Cd300lg A G 11: 102,054,169 M358V possibly damaging Het
Cdh23 A G 10: 60,410,821 V949A possibly damaging Het
Cenpo C T 12: 4,216,733 S126N probably benign Het
Chd3 A T 11: 69,352,677 D1366E probably damaging Het
Chd4 A G 6: 125,101,285 E169G possibly damaging Het
Clec1b A G 6: 129,401,477 T24A possibly damaging Het
Clhc1 A G 11: 29,578,145 I558V probably damaging Het
Col5a2 T A 1: 45,376,666 R1440S probably damaging Het
Cops3 A G 11: 59,817,901 probably benign Het
Cxcr4 A G 1: 128,589,450 V158A probably damaging Het
Dnah7a A G 1: 53,419,636 M3781T probably damaging Het
Fbln7 G T 2: 128,895,340 M358I probably damaging Het
Fbxl13 C T 5: 21,484,021 R763Q possibly damaging Het
Gabrr3 C A 16: 59,448,108 N361K probably benign Het
Gbp7 A G 3: 142,545,993 M534V probably benign Het
Hcar2 G A 5: 123,864,954 T162I probably benign Het
Hdc A T 2: 126,593,977 L658Q probably damaging Het
Hivep3 A G 4: 120,098,405 Y1306C probably damaging Het
Homer3 C T 8: 70,285,524 R49C probably damaging Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Iqgap3 A G 3: 88,091,515 N308D probably benign Het
Itga8 G A 2: 12,193,509 T555M probably damaging Het
Lrfn5 G T 12: 61,839,470 V15L probably benign Het
Lrrk1 T C 7: 66,302,710 K493E possibly damaging Het
Lyzl6 A G 11: 103,635,063 I77T probably damaging Het
Mavs G T 2: 131,240,391 R65L probably damaging Het
Mdn1 T G 4: 32,696,269 D1217E probably benign Het
Olfr103 A T 17: 37,336,708 F175I possibly damaging Het
Olfr1502 A G 19: 13,862,574 I260M probably benign Het
Olfr648 A T 7: 104,179,747 Y220* probably null Het
Otof C A 5: 30,371,900 V1762L probably damaging Het
Pcdha12 T C 18: 37,020,321 L31P probably damaging Het
Pxk C A 14: 8,163,952 P515T probably damaging Het
Qrich2 A T 11: 116,453,542 D1759E probably benign Het
Rps6ka1 A T 4: 133,869,306 F33Y probably damaging Het
Rxfp2 G A 5: 150,044,126 probably null Het
Slc23a4 A T 6: 34,956,961 I202N probably damaging Het
Slc24a5 A T 2: 125,088,251 I491F probably benign Het
Slco1a1 T A 6: 141,909,049 K625N probably benign Het
Snx31 A G 15: 36,546,885 V51A probably damaging Het
Sox6 G T 7: 115,801,462 H48Q probably damaging Het
Tas2r109 A T 6: 132,980,624 Y114* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Timm13 A C 10: 80,900,480 probably null Het
Tpsb2 G A 17: 25,367,763 A250T possibly damaging Het
Trpm6 T C 19: 18,783,128 I131T probably damaging Het
Vars2 A T 17: 35,665,662 probably null Het
Vmn2r35 T A 7: 7,786,528 I737F probably damaging Het
Wdr46 C A 17: 33,944,485 T339K probably damaging Het
Other mutations in Elovl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Elovl5 APN 9 77960974 missense probably benign 0.12
IGL01017:Elovl5 APN 9 77981571 missense possibly damaging 0.67
IGL02331:Elovl5 APN 9 77979899 missense possibly damaging 0.81
IGL02851:Elovl5 APN 9 77981502 missense probably damaging 1.00
IGL03011:Elovl5 APN 9 77982784 missense probably benign 0.32
euge UTSW 9 77979823 critical splice acceptor site probably null
laid-up UTSW 9 77981502 missense probably damaging 0.99
R0452:Elovl5 UTSW 9 77960911 missense probably damaging 1.00
R0494:Elovl5 UTSW 9 77960917 missense probably benign 0.05
R3706:Elovl5 UTSW 9 77979837 missense probably null 1.00
R4353:Elovl5 UTSW 9 77960917 missense probably benign 0.05
R6640:Elovl5 UTSW 9 77979913 nonsense probably null
R7804:Elovl5 UTSW 9 77979823 critical splice acceptor site probably null
R8179:Elovl5 UTSW 9 77976899 missense probably damaging 1.00
RF031:Elovl5 UTSW 9 77981473 critical splice acceptor site probably null
Z1176:Elovl5 UTSW 9 77976755 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GCGAACCTATAGTAGAGGCATAC -3'
(R):5'- TTTCAAAGCACAGTGCCAGC -3'

Sequencing Primer
(F):5'- CCTATAGTAGAGGCATACACAGAG -3'
(R):5'- TCCCAGCAGTGCACCAG -3'
Posted On2018-02-27