Mutagenetix > Incidental Mutation

Incidental Mutation 'R6211:Cdh23'

503464

Institutional Source

Beutler Lab

Gene Symbol

Cdh23

Ensembl Gene

ENSMUSG00000012819

Gene Name

cadherin related 23 (otocadherin)

Synonyms

bob, sals, USH1D, ahl, mdfw, nmf252, 4930542A03Rik, nmf112, nmf181

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.388) question?

Stock #

R6211 (G1)

Quality Score

177.009

Status

Validated

Chromosome

Chromosomal Location

60138527-60532269 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 60246600 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 949 (V949A)

Ref Sequence

ENSEMBL: ENSMUSP00000101102 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073242] [ENSMUST00000105461] [ENSMUST00000105462] [ENSMUST00000105463] [ENSMUST00000105464]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000073242
AA Change: V946A

PolyPhen 2 Score 0.776 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819
AA Change: V946A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	8.11e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1415	1.21e-18	SMART
CA	1440	1524	2.38e-26	SMART
CA	1549	1631	6.27e-26	SMART
CA	1656	1741	6.99e-24	SMART
CA	1765	1848	3.49e-24	SMART
CA	1872	1956	2.78e-18	SMART
CA	1984	2066	5.6e-14	SMART
CA	2090	2171	2.59e-27	SMART
CA	2195	2290	2.87e-11	SMART
CA	2317	2399	1.01e-20	SMART
CA	2423	2506	1.09e-25	SMART
CA	2530	2608	7.91e-23	SMART
CA	2634	2719	1.06e-23	SMART
CA	2750	2843	2e-10	SMART
Blast:CA	2867	2956	4e-51	BLAST
transmembrane domain	3067	3089	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105461
AA Change: V946A

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819
AA Change: V946A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	1.25e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1416	5.26e-19	SMART
CA	1441	1525	2.38e-26	SMART
CA	1550	1632	6.27e-26	SMART
CA	1657	1742	6.99e-24	SMART
CA	1766	1849	3.49e-24	SMART
CA	1873	1957	2.78e-18	SMART
CA	1985	2067	5.6e-14	SMART
CA	2091	2172	2.59e-27	SMART
CA	2196	2291	2.87e-11	SMART
CA	2318	2400	1.01e-20	SMART
CA	2424	2507	1.09e-25	SMART
CA	2531	2609	7.91e-23	SMART
CA	2635	2720	1.06e-23	SMART
CA	2751	2844	2e-10	SMART
Blast:CA	2868	2957	4e-51	BLAST
transmembrane domain	3068	3090	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105462
AA Change: V949A

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819
AA Change: V949A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	261	349	2.03e-11	SMART
CA	374	461	8.11e-11	SMART
CA	485	562	1.04e-22	SMART
CA	586	672	3.55e-25	SMART
CA	696	779	2.04e-25	SMART
CA	803	891	5.03e-16	SMART
CA	915	996	1.05e-27	SMART
CA	1020	1103	1.99e-19	SMART
CA	1127	1209	6.94e-19	SMART
CA	1234	1314	1.99e-19	SMART
CA	1338	1418	1.21e-18	SMART
CA	1443	1527	2.38e-26	SMART
CA	1552	1634	6.27e-26	SMART
CA	1659	1744	6.99e-24	SMART
CA	1768	1851	3.49e-24	SMART
CA	1875	1959	2.78e-18	SMART
CA	1987	2069	5.6e-14	SMART
CA	2093	2174	2.59e-27	SMART
CA	2198	2293	2.87e-11	SMART
CA	2320	2402	1.01e-20	SMART
CA	2426	2509	1.09e-25	SMART
CA	2533	2611	7.91e-23	SMART
CA	2637	2722	1.06e-23	SMART
CA	2753	2846	2e-10	SMART
Blast:CA	2870	2959	4e-51	BLAST
transmembrane domain	3070	3092	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105463
AA Change: V946A

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819
AA Change: V946A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	1.25e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1416	5.26e-19	SMART
CA	1441	1525	2.38e-26	SMART
CA	1550	1632	6.27e-26	SMART
CA	1657	1742	6.99e-24	SMART
CA	1766	1849	3.49e-24	SMART
CA	1873	1957	2.78e-18	SMART
CA	1985	2067	5.6e-14	SMART
CA	2091	2172	2.59e-27	SMART
CA	2196	2291	2.87e-11	SMART
CA	2318	2400	1.01e-20	SMART
CA	2424	2507	1.09e-25	SMART
CA	2531	2609	7.91e-23	SMART
CA	2635	2720	1.06e-23	SMART
CA	2751	2844	2e-10	SMART
Blast:CA	2868	2957	4e-51	BLAST
transmembrane domain	3068	3090	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105464
AA Change: V944A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819
AA Change: V944A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	456	3.58e-12	SMART
CA	480	557	1.04e-22	SMART
CA	581	667	3.55e-25	SMART
CA	691	774	2.04e-25	SMART
CA	798	886	5.03e-16	SMART
CA	910	991	1.05e-27	SMART
CA	1015	1098	1.99e-19	SMART
CA	1122	1204	6.94e-19	SMART
CA	1229	1309	1.99e-19	SMART
CA	1333	1414	5.26e-19	SMART
CA	1439	1523	2.38e-26	SMART
CA	1548	1630	6.27e-26	SMART
CA	1655	1740	6.99e-24	SMART
CA	1764	1847	3.49e-24	SMART
CA	1871	1955	2.78e-18	SMART
CA	1983	2065	5.6e-14	SMART
CA	2089	2170	2.59e-27	SMART
CA	2194	2289	2.87e-11	SMART
CA	2316	2398	1.01e-20	SMART
CA	2422	2505	1.09e-25	SMART
CA	2529	2607	7.91e-23	SMART
CA	2633	2718	1.06e-23	SMART
CA	2749	2842	2e-10	SMART
Blast:CA	2866	2955	3e-51	BLAST
transmembrane domain	3066	3088	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128249

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135638

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144462

Meta Mutation Damage Score

0.1260

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.6%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]
PHENOTYPE: Mutant mice exhibit circling behavior, tilting of the head and are deaf. Mice homozygous for a targeted knock-out exhibit abnormal outer hair cells morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acin1	A	T	14: 54,881,503 (GRCm39)	W391R	probably damaging	Het
Arl6ip1	A	T	7: 117,726,473 (GRCm39)	S18R	probably benign	Het
Armc3	G	A	2: 19,301,614 (GRCm39)		probably null	Het
Ccdc162	G	T	10: 41,506,141 (GRCm39)	S883*	probably null	Het
Cd300lg	A	G	11: 101,944,995 (GRCm39)	M358V	possibly damaging	Het
Cenpo	C	T	12: 4,266,733 (GRCm39)	S126N	probably benign	Het
Chd3	A	T	11: 69,243,503 (GRCm39)	D1366E	probably damaging	Het
Chd4	A	G	6: 125,078,248 (GRCm39)	E169G	possibly damaging	Het
Clec1b	A	G	6: 129,378,440 (GRCm39)	T24A	possibly damaging	Het
Clhc1	A	G	11: 29,528,145 (GRCm39)	I558V	probably damaging	Het
Col5a2	T	A	1: 45,415,826 (GRCm39)	R1440S	probably damaging	Het
Cops3	A	G	11: 59,708,727 (GRCm39)		probably benign	Het
Cxcr4	A	G	1: 128,517,187 (GRCm39)	V158A	probably damaging	Het
Dnah7a	A	G	1: 53,458,795 (GRCm39)	M3781T	probably damaging	Het
Dnai7	C	T	6: 145,146,217 (GRCm39)	R95Q	probably damaging	Het
Elovl5	C	A	9: 77,888,784 (GRCm39)	T217K	probably damaging	Het
Fbln7	G	T	2: 128,737,260 (GRCm39)	M358I	probably damaging	Het
Fbxl13	C	T	5: 21,689,019 (GRCm39)	R763Q	possibly damaging	Het
Gabrr3	C	A	16: 59,268,471 (GRCm39)	N361K	probably benign	Het
Garre1	A	T	7: 33,938,429 (GRCm39)	H1035Q	possibly damaging	Het
Gbp7	A	G	3: 142,251,754 (GRCm39)	M534V	probably benign	Het
Hcar2	G	A	5: 124,003,017 (GRCm39)	T162I	probably benign	Het
Hdc	A	T	2: 126,435,897 (GRCm39)	L658Q	probably damaging	Het
Hivep3	A	G	4: 119,955,602 (GRCm39)	Y1306C	probably damaging	Het
Homer3	C	T	8: 70,738,174 (GRCm39)	R49C	probably damaging	Het
Hspa4	C	T	11: 53,153,766 (GRCm39)	E702K	probably benign	Het
Iqgap3	A	G	3: 87,998,822 (GRCm39)	N308D	probably benign	Het
Itga8	G	A	2: 12,198,320 (GRCm39)	T555M	probably damaging	Het
Lrfn5	G	T	12: 61,886,256 (GRCm39)	V15L	probably benign	Het
Lrrk1	T	C	7: 65,952,458 (GRCm39)	K493E	possibly damaging	Het
Lyzl6	A	G	11: 103,525,889 (GRCm39)	I77T	probably damaging	Het
Mavs	G	T	2: 131,082,311 (GRCm39)	R65L	probably damaging	Het
Mdn1	T	G	4: 32,696,269 (GRCm39)	D1217E	probably benign	Het
Or12d13	A	T	17: 37,647,599 (GRCm39)	F175I	possibly damaging	Het
Or52h1	A	T	7: 103,828,954 (GRCm39)	Y220*	probably null	Het
Or9i1	A	G	19: 13,839,938 (GRCm39)	I260M	probably benign	Het
Otof	C	A	5: 30,529,244 (GRCm39)	V1762L	probably damaging	Het
Pcdha12	T	C	18: 37,153,374 (GRCm39)	L31P	probably damaging	Het
Pxk	C	A	14: 8,163,952 (GRCm38)	P515T	probably damaging	Het
Qrich2	A	T	11: 116,344,368 (GRCm39)	D1759E	probably benign	Het
Rps6ka1	A	T	4: 133,596,617 (GRCm39)	F33Y	probably damaging	Het
Rxfp2	G	A	5: 149,967,591 (GRCm39)		probably null	Het
Slc23a4	A	T	6: 34,933,896 (GRCm39)	I202N	probably damaging	Het
Slc24a5	A	T	2: 124,930,171 (GRCm39)	I491F	probably benign	Het
Slco1a1	T	A	6: 141,854,775 (GRCm39)	K625N	probably benign	Het
Snx31	A	G	15: 36,547,030 (GRCm39)	V51A	probably damaging	Het
Sox6	G	T	7: 115,400,697 (GRCm39)	H48Q	probably damaging	Het
Tas2r109	A	T	6: 132,957,587 (GRCm39)	Y114*	probably null	Het
Tbc1d2	C	T	4: 46,629,912 (GRCm39)	G252R	probably benign	Het
Timm13	A	C	10: 80,736,314 (GRCm39)		probably null	Het
Tpsb2	G	A	17: 25,586,737 (GRCm39)	A250T	possibly damaging	Het
Trpm6	T	C	19: 18,760,492 (GRCm39)	I131T	probably damaging	Het
Vars2	A	T	17: 35,976,554 (GRCm39)		probably null	Het
Vmn2r35	T	A	7: 7,789,527 (GRCm39)	I737F	probably damaging	Het
Wdr46	C	A	17: 34,163,459 (GRCm39)	T339K	probably damaging	Het

Other mutations in Cdh23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Cdh23	APN	10	60,359,327 (GRCm39)	missense	probably benign	0.03
IGL00429:Cdh23	APN	10	60,256,920 (GRCm39)	missense	probably damaging	0.97
IGL01014:Cdh23	APN	10	60,143,301 (GRCm39)	missense	probably damaging	0.99
IGL01284:Cdh23	APN	10	60,301,876 (GRCm39)	missense	possibly damaging	0.95
IGL01305:Cdh23	APN	10	60,148,403 (GRCm39)	missense	probably damaging	1.00
IGL01367:Cdh23	APN	10	60,146,566 (GRCm39)	missense	probably damaging	1.00
IGL01396:Cdh23	APN	10	60,220,848 (GRCm39)	missense	possibly damaging	0.93
IGL01412:Cdh23	APN	10	60,150,473 (GRCm39)	missense	probably damaging	1.00
IGL01461:Cdh23	APN	10	60,244,926 (GRCm39)	missense	possibly damaging	0.53
IGL01469:Cdh23	APN	10	60,433,504 (GRCm39)	missense	probably benign	0.03
IGL01695:Cdh23	APN	10	60,167,612 (GRCm39)	missense	probably benign	0.20
IGL01734:Cdh23	APN	10	60,139,292 (GRCm39)	missense	probably benign
IGL01767:Cdh23	APN	10	60,151,503 (GRCm39)	missense	probably damaging	1.00
IGL01796:Cdh23	APN	10	60,146,916 (GRCm39)	missense	probably benign	0.31
IGL01843:Cdh23	APN	10	60,255,598 (GRCm39)	splice site	probably null
IGL02025:Cdh23	APN	10	60,220,922 (GRCm39)	missense	probably damaging	1.00
IGL02071:Cdh23	APN	10	60,359,339 (GRCm39)	missense	possibly damaging	0.93
IGL02160:Cdh23	APN	10	60,433,544 (GRCm39)	splice site	probably benign
IGL02175:Cdh23	APN	10	60,167,087 (GRCm39)	missense	possibly damaging	0.92
IGL02220:Cdh23	APN	10	60,140,903 (GRCm39)	missense	probably damaging	1.00
IGL02302:Cdh23	APN	10	60,159,302 (GRCm39)	missense	possibly damaging	0.87
IGL02331:Cdh23	APN	10	60,301,322 (GRCm39)	missense	probably damaging	0.99
IGL02452:Cdh23	APN	10	60,153,721 (GRCm39)	missense	probably damaging	0.99
IGL02499:Cdh23	APN	10	60,220,958 (GRCm39)	missense	probably damaging	1.00
IGL02548:Cdh23	APN	10	60,485,901 (GRCm39)	missense	probably benign	0.37
IGL02593:Cdh23	APN	10	60,301,774 (GRCm39)	splice site	probably benign
IGL02626:Cdh23	APN	10	60,227,580 (GRCm39)	missense	probably damaging	1.00
IGL02951:Cdh23	APN	10	60,147,143 (GRCm39)	missense	probably damaging	1.00
IGL03145:Cdh23	APN	10	60,212,593 (GRCm39)	missense	probably damaging	0.99
dee_dee	UTSW	10	60,143,835 (GRCm39)	nonsense	probably null
hersey	UTSW	10	60,143,815 (GRCm39)	missense	probably damaging	1.00
ANU22:Cdh23	UTSW	10	60,148,403 (GRCm39)	missense	probably damaging	1.00
IGL02980:Cdh23	UTSW	10	60,150,399 (GRCm39)	missense	probably damaging	1.00
PIT4362001:Cdh23	UTSW	10	60,301,237 (GRCm39)	missense	probably benign	0.15
R0013:Cdh23	UTSW	10	60,248,952 (GRCm39)	missense	possibly damaging	0.90
R0045:Cdh23	UTSW	10	60,366,757 (GRCm39)	missense	probably damaging	1.00
R0045:Cdh23	UTSW	10	60,366,757 (GRCm39)	missense	probably damaging	1.00
R0082:Cdh23	UTSW	10	60,148,366 (GRCm39)	missense	probably damaging	1.00
R0124:Cdh23	UTSW	10	60,143,835 (GRCm39)	nonsense	probably null
R0172:Cdh23	UTSW	10	60,155,411 (GRCm39)	missense	probably damaging	1.00
R0195:Cdh23	UTSW	10	60,152,838 (GRCm39)	missense	probably damaging	0.99
R0365:Cdh23	UTSW	10	60,215,094 (GRCm39)	missense	probably damaging	0.99
R0437:Cdh23	UTSW	10	60,246,576 (GRCm39)	missense	probably damaging	1.00
R0486:Cdh23	UTSW	10	60,222,725 (GRCm39)	missense	probably damaging	1.00
R0494:Cdh23	UTSW	10	60,152,375 (GRCm39)	splice site	probably benign
R0545:Cdh23	UTSW	10	60,167,070 (GRCm39)	missense	probably benign	0.06
R0619:Cdh23	UTSW	10	60,269,556 (GRCm39)	missense	probably damaging	1.00
R0647:Cdh23	UTSW	10	60,159,153 (GRCm39)	nonsense	probably null
R0647:Cdh23	UTSW	10	60,143,681 (GRCm39)	missense	probably damaging	0.99
R0730:Cdh23	UTSW	10	60,159,493 (GRCm39)	missense	probably damaging	0.99
R0880:Cdh23	UTSW	10	60,242,200 (GRCm39)	missense	possibly damaging	0.51
R0942:Cdh23	UTSW	10	60,246,639 (GRCm39)	missense	possibly damaging	0.67
R0989:Cdh23	UTSW	10	60,370,289 (GRCm39)	missense	probably damaging	0.99
R1017:Cdh23	UTSW	10	60,167,572 (GRCm39)	missense	probably damaging	1.00
R1173:Cdh23	UTSW	10	60,148,171 (GRCm39)	splice site	probably benign
R1449:Cdh23	UTSW	10	60,212,730 (GRCm39)	missense	probably damaging	1.00
R1456:Cdh23	UTSW	10	60,322,899 (GRCm39)	missense	possibly damaging	0.84
R1519:Cdh23	UTSW	10	60,215,122 (GRCm39)	missense	possibly damaging	0.92
R1532:Cdh23	UTSW	10	60,150,110 (GRCm39)	missense	probably damaging	0.99
R1559:Cdh23	UTSW	10	60,255,478 (GRCm39)	splice site	probably benign
R1704:Cdh23	UTSW	10	60,150,390 (GRCm39)	missense	probably damaging	1.00
R1711:Cdh23	UTSW	10	60,359,315 (GRCm39)	missense	probably benign	0.07
R1760:Cdh23	UTSW	10	60,161,855 (GRCm39)	missense	probably damaging	1.00
R1782:Cdh23	UTSW	10	60,324,321 (GRCm39)	missense	probably damaging	1.00
R1791:Cdh23	UTSW	10	60,227,505 (GRCm39)	missense	possibly damaging	0.89
R1803:Cdh23	UTSW	10	60,167,060 (GRCm39)	missense	probably damaging	1.00
R1857:Cdh23	UTSW	10	60,159,076 (GRCm39)	missense	probably damaging	1.00
R1874:Cdh23	UTSW	10	60,272,597 (GRCm39)	missense	possibly damaging	0.52
R1914:Cdh23	UTSW	10	60,159,349 (GRCm39)	missense	probably damaging	0.99
R1958:Cdh23	UTSW	10	60,246,652 (GRCm39)	missense	probably benign	0.02
R1964:Cdh23	UTSW	10	60,221,001 (GRCm39)	missense	probably benign	0.31
R1966:Cdh23	UTSW	10	60,159,361 (GRCm39)	missense	probably damaging	1.00
R1981:Cdh23	UTSW	10	60,214,530 (GRCm39)	missense	probably damaging	1.00
R2010:Cdh23	UTSW	10	60,150,006 (GRCm39)	missense	probably damaging	0.99
R2036:Cdh23	UTSW	10	60,301,822 (GRCm39)	missense	possibly damaging	0.52
R2038:Cdh23	UTSW	10	60,148,366 (GRCm39)	missense	probably damaging	1.00
R2044:Cdh23	UTSW	10	60,432,509 (GRCm39)	missense	possibly damaging	0.72
R2111:Cdh23	UTSW	10	60,141,362 (GRCm39)	missense	probably damaging	0.99
R2112:Cdh23	UTSW	10	60,141,362 (GRCm39)	missense	probably damaging	0.99
R2211:Cdh23	UTSW	10	60,301,783 (GRCm39)	missense	possibly damaging	0.92
R2261:Cdh23	UTSW	10	60,152,907 (GRCm39)	missense	probably damaging	1.00
R2262:Cdh23	UTSW	10	60,152,907 (GRCm39)	missense	probably damaging	1.00
R2306:Cdh23	UTSW	10	60,159,224 (GRCm39)	missense	probably damaging	1.00
R2344:Cdh23	UTSW	10	60,152,503 (GRCm39)	missense	probably damaging	1.00
R2857:Cdh23	UTSW	10	60,218,432 (GRCm39)	critical splice donor site	probably null
R2858:Cdh23	UTSW	10	60,218,432 (GRCm39)	critical splice donor site	probably null
R2859:Cdh23	UTSW	10	60,218,432 (GRCm39)	critical splice donor site	probably null
R2876:Cdh23	UTSW	10	60,143,275 (GRCm39)	missense	probably damaging	1.00
R3034:Cdh23	UTSW	10	60,244,789 (GRCm39)	splice site	probably benign
R3424:Cdh23	UTSW	10	60,212,660 (GRCm39)	missense	possibly damaging	0.76
R3699:Cdh23	UTSW	10	60,163,149 (GRCm39)	critical splice donor site	probably null
R3700:Cdh23	UTSW	10	60,163,149 (GRCm39)	critical splice donor site	probably null
R3950:Cdh23	UTSW	10	60,493,105 (GRCm39)	missense	probably benign	0.04
R3951:Cdh23	UTSW	10	60,493,105 (GRCm39)	missense	probably benign	0.04
R3952:Cdh23	UTSW	10	60,493,105 (GRCm39)	missense	probably benign	0.04
R4108:Cdh23	UTSW	10	60,246,601 (GRCm39)	missense	possibly damaging	0.51
R4114:Cdh23	UTSW	10	60,256,819 (GRCm39)	splice site	probably null
R4273:Cdh23	UTSW	10	60,146,940 (GRCm39)	missense	possibly damaging	0.69
R4284:Cdh23	UTSW	10	60,139,272 (GRCm39)	missense	possibly damaging	0.91
R4334:Cdh23	UTSW	10	60,220,838 (GRCm39)	missense	probably damaging	0.99
R4474:Cdh23	UTSW	10	60,146,865 (GRCm39)	missense	probably damaging	1.00
R4532:Cdh23	UTSW	10	60,370,202 (GRCm39)	missense	probably benign	0.32
R4597:Cdh23	UTSW	10	60,244,823 (GRCm39)	missense	probably damaging	1.00
R4604:Cdh23	UTSW	10	60,173,445 (GRCm39)	missense	possibly damaging	0.93
R4793:Cdh23	UTSW	10	60,167,129 (GRCm39)	missense	probably damaging	1.00
R4816:Cdh23	UTSW	10	60,244,856 (GRCm39)	missense	possibly damaging	0.93
R4833:Cdh23	UTSW	10	60,220,817 (GRCm39)	missense	probably damaging	1.00
R4840:Cdh23	UTSW	10	60,255,556 (GRCm39)	missense	possibly damaging	0.53
R4857:Cdh23	UTSW	10	60,227,563 (GRCm39)	missense	probably damaging	1.00
R4869:Cdh23	UTSW	10	60,212,713 (GRCm39)	missense	probably damaging	1.00
R4894:Cdh23	UTSW	10	60,173,630 (GRCm39)	missense	probably benign	0.04
R4940:Cdh23	UTSW	10	60,143,714 (GRCm39)	missense	probably damaging	0.98
R5020:Cdh23	UTSW	10	60,143,811 (GRCm39)	missense	probably damaging	0.99
R5026:Cdh23	UTSW	10	60,140,627 (GRCm39)	missense	possibly damaging	0.88
R5081:Cdh23	UTSW	10	60,272,586 (GRCm39)	missense	possibly damaging	0.89
R5138:Cdh23	UTSW	10	60,148,061 (GRCm39)	missense	probably damaging	1.00
R5236:Cdh23	UTSW	10	60,148,351 (GRCm39)	missense	probably damaging	1.00
R5361:Cdh23	UTSW	10	60,493,044 (GRCm39)	critical splice donor site	probably null
R5384:Cdh23	UTSW	10	60,173,541 (GRCm39)	missense	probably damaging	0.99
R5500:Cdh23	UTSW	10	60,150,090 (GRCm39)	missense	probably damaging	1.00
R5512:Cdh23	UTSW	10	60,370,165 (GRCm39)	splice site	probably null
R5673:Cdh23	UTSW	10	60,143,636 (GRCm39)	missense	probably damaging	1.00
R5720:Cdh23	UTSW	10	60,228,802 (GRCm39)	missense	possibly damaging	0.71
R5726:Cdh23	UTSW	10	60,243,259 (GRCm39)	missense	probably damaging	0.98
R5732:Cdh23	UTSW	10	60,167,096 (GRCm39)	missense	possibly damaging	0.80
R5739:Cdh23	UTSW	10	60,141,388 (GRCm39)	missense	probably damaging	0.99
R5760:Cdh23	UTSW	10	60,242,171 (GRCm39)	missense	probably damaging	0.99
R5793:Cdh23	UTSW	10	60,141,907 (GRCm39)	missense	probably damaging	1.00
R5880:Cdh23	UTSW	10	60,220,713 (GRCm39)	missense	probably damaging	1.00
R5905:Cdh23	UTSW	10	60,370,314 (GRCm39)	missense	probably damaging	0.98
R5907:Cdh23	UTSW	10	60,264,158 (GRCm39)	missense	probably damaging	1.00
R5910:Cdh23	UTSW	10	60,213,600 (GRCm39)	missense	possibly damaging	0.81
R5932:Cdh23	UTSW	10	60,228,763 (GRCm39)	missense	probably damaging	1.00
R5996:Cdh23	UTSW	10	60,249,356 (GRCm39)	missense	possibly damaging	0.85
R6015:Cdh23	UTSW	10	60,143,761 (GRCm39)	missense	probably damaging	0.97
R6020:Cdh23	UTSW	10	60,167,105 (GRCm39)	missense	probably damaging	1.00
R6023:Cdh23	UTSW	10	60,301,321 (GRCm39)	missense	probably damaging	1.00
R6028:Cdh23	UTSW	10	60,370,314 (GRCm39)	missense	probably damaging	0.98
R6066:Cdh23	UTSW	10	60,269,537 (GRCm39)	missense	probably damaging	1.00
R6137:Cdh23	UTSW	10	60,270,291 (GRCm39)	missense	probably damaging	0.96
R6298:Cdh23	UTSW	10	60,262,451 (GRCm39)	nonsense	probably null
R6302:Cdh23	UTSW	10	60,140,872 (GRCm39)	missense	possibly damaging	0.74
R6338:Cdh23	UTSW	10	60,248,930 (GRCm39)	missense	probably damaging	1.00
R6356:Cdh23	UTSW	10	60,274,626 (GRCm39)	missense	probably damaging	1.00
R6441:Cdh23	UTSW	10	60,143,815 (GRCm39)	missense	probably damaging	1.00
R6714:Cdh23	UTSW	10	60,167,609 (GRCm39)	missense	possibly damaging	0.62
R6760:Cdh23	UTSW	10	60,141,947 (GRCm39)	missense	probably damaging	1.00
R6807:Cdh23	UTSW	10	60,214,650 (GRCm39)	missense	possibly damaging	0.95
R6855:Cdh23	UTSW	10	60,141,901 (GRCm39)	missense	possibly damaging	0.66
R6937:Cdh23	UTSW	10	60,322,893 (GRCm39)	missense	probably damaging	1.00
R6942:Cdh23	UTSW	10	60,274,635 (GRCm39)	missense	possibly damaging	0.93
R6961:Cdh23	UTSW	10	60,485,893 (GRCm39)	missense	probably benign	0.00
R7009:Cdh23	UTSW	10	60,173,085 (GRCm39)	missense	probably damaging	0.99
R7010:Cdh23	UTSW	10	60,366,770 (GRCm39)	missense	probably benign	0.03
R7032:Cdh23	UTSW	10	60,167,567 (GRCm39)	missense	probably damaging	1.00
R7046:Cdh23	UTSW	10	60,214,530 (GRCm39)	missense	probably damaging	1.00
R7111:Cdh23	UTSW	10	60,222,823 (GRCm39)	missense	probably damaging	1.00
R7196:Cdh23	UTSW	10	60,143,759 (GRCm39)	missense	probably damaging	0.99
R7198:Cdh23	UTSW	10	60,148,378 (GRCm39)	missense	possibly damaging	0.91
R7223:Cdh23	UTSW	10	60,167,596 (GRCm39)	missense	probably damaging	1.00
R7290:Cdh23	UTSW	10	60,212,620 (GRCm39)	missense	probably benign
R7335:Cdh23	UTSW	10	60,140,895 (GRCm39)	missense	probably damaging	1.00
R7340:Cdh23	UTSW	10	60,366,775 (GRCm39)	missense	probably benign	0.19
R7350:Cdh23	UTSW	10	60,246,689 (GRCm39)	missense	probably damaging	1.00
R7366:Cdh23	UTSW	10	60,151,471 (GRCm39)	nonsense	probably null
R7374:Cdh23	UTSW	10	60,153,679 (GRCm39)	missense	probably damaging	0.99
R7455:Cdh23	UTSW	10	60,142,003 (GRCm39)	missense	possibly damaging	0.82
R7537:Cdh23	UTSW	10	60,220,724 (GRCm39)	missense	probably benign	0.17
R7573:Cdh23	UTSW	10	60,159,329 (GRCm39)	missense	probably benign	0.17
R7578:Cdh23	UTSW	10	60,243,186 (GRCm39)	missense	probably benign	0.14
R7646:Cdh23	UTSW	10	60,140,931 (GRCm39)	missense	possibly damaging	0.95
R7703:Cdh23	UTSW	10	60,173,043 (GRCm39)	missense	probably damaging	1.00
R7763:Cdh23	UTSW	10	60,148,356 (GRCm39)	missense	probably damaging	1.00
R7797:Cdh23	UTSW	10	60,220,973 (GRCm39)	missense	probably benign	0.07
R7867:Cdh23	UTSW	10	60,150,390 (GRCm39)	missense	probably damaging	1.00
R7878:Cdh23	UTSW	10	60,149,979 (GRCm39)	missense	possibly damaging	0.69
R7915:Cdh23	UTSW	10	60,143,668 (GRCm39)	missense	probably damaging	0.97
R7922:Cdh23	UTSW	10	60,218,485 (GRCm39)	missense	probably benign	0.31
R7963:Cdh23	UTSW	10	60,171,967 (GRCm39)	missense	probably damaging	1.00
R7997:Cdh23	UTSW	10	60,432,518 (GRCm39)	missense	possibly damaging	0.81
R8167:Cdh23	UTSW	10	60,150,162 (GRCm39)	missense	probably benign	0.12
R8167:Cdh23	UTSW	10	60,173,472 (GRCm39)	missense	probably damaging	0.96
R8258:Cdh23	UTSW	10	60,151,435 (GRCm39)	missense	probably damaging	0.99
R8259:Cdh23	UTSW	10	60,151,435 (GRCm39)	missense	probably damaging	0.99
R8317:Cdh23	UTSW	10	60,272,568 (GRCm39)	missense	probably damaging	1.00
R8317:Cdh23	UTSW	10	60,147,037 (GRCm39)	critical splice donor site	probably null
R8326:Cdh23	UTSW	10	60,274,591 (GRCm39)	missense	possibly damaging	0.55
R8333:Cdh23	UTSW	10	60,150,390 (GRCm39)	missense	probably damaging	1.00
R8348:Cdh23	UTSW	10	60,167,507 (GRCm39)	missense	probably benign	0.43
R8366:Cdh23	UTSW	10	60,160,799 (GRCm39)	missense	probably benign
R8504:Cdh23	UTSW	10	60,274,618 (GRCm39)	missense	probably benign	0.00
R8676:Cdh23	UTSW	10	60,246,689 (GRCm39)	missense	probably damaging	1.00
R8781:Cdh23	UTSW	10	60,167,567 (GRCm39)	missense	probably damaging	1.00
R8785:Cdh23	UTSW	10	60,147,114 (GRCm39)	missense	probably damaging	1.00
R8788:Cdh23	UTSW	10	60,324,372 (GRCm39)	missense	probably damaging	1.00
R8802:Cdh23	UTSW	10	60,244,877 (GRCm39)	missense	probably benign	0.04
R8837:Cdh23	UTSW	10	60,160,755 (GRCm39)	missense	probably benign	0.28
R8863:Cdh23	UTSW	10	60,212,613 (GRCm39)	nonsense	probably null
R8889:Cdh23	UTSW	10	60,143,284 (GRCm39)	missense	probably damaging	0.97
R8892:Cdh23	UTSW	10	60,143,284 (GRCm39)	missense	probably damaging	0.97
R8921:Cdh23	UTSW	10	60,140,908 (GRCm39)	missense	probably damaging	0.99
R8980:Cdh23	UTSW	10	60,173,625 (GRCm39)	missense	probably benign	0.06
R9000:Cdh23	UTSW	10	60,140,277 (GRCm39)	missense	possibly damaging	0.82
R9043:Cdh23	UTSW	10	60,151,478 (GRCm39)	missense	probably benign	0.00
R9046:Cdh23	UTSW	10	60,218,303 (GRCm39)	intron	probably benign
R9070:Cdh23	UTSW	10	60,173,539 (GRCm39)	missense	probably benign
R9075:Cdh23	UTSW	10	60,153,541 (GRCm39)	missense	probably damaging	1.00
R9132:Cdh23	UTSW	10	60,270,283 (GRCm39)	splice site	probably benign
R9155:Cdh23	UTSW	10	60,249,485 (GRCm39)	missense	probably damaging	0.99
R9171:Cdh23	UTSW	10	60,161,810 (GRCm39)	missense	probably benign	0.00
R9179:Cdh23	UTSW	10	60,153,664 (GRCm39)	missense	probably benign	0.06
R9186:Cdh23	UTSW	10	60,143,306 (GRCm39)	missense	possibly damaging	0.54
R9189:Cdh23	UTSW	10	60,143,306 (GRCm39)	missense	possibly damaging	0.54
R9207:Cdh23	UTSW	10	60,243,210 (GRCm39)	missense	probably damaging	1.00
R9240:Cdh23	UTSW	10	60,215,044 (GRCm39)	missense	probably benign	0.00
R9244:Cdh23	UTSW	10	60,249,442 (GRCm39)	missense	possibly damaging	0.93
R9284:Cdh23	UTSW	10	60,143,306 (GRCm39)	missense	possibly damaging	0.54
R9286:Cdh23	UTSW	10	60,143,306 (GRCm39)	missense	possibly damaging	0.54
R9287:Cdh23	UTSW	10	60,143,306 (GRCm39)	missense	possibly damaging	0.54
R9302:Cdh23	UTSW	10	60,143,306 (GRCm39)	missense	possibly damaging	0.54
R9352:Cdh23	UTSW	10	60,143,306 (GRCm39)	missense	possibly damaging	0.54
R9353:Cdh23	UTSW	10	60,143,306 (GRCm39)	missense	possibly damaging	0.54
R9423:Cdh23	UTSW	10	60,148,387 (GRCm39)	missense	probably damaging	1.00
R9513:Cdh23	UTSW	10	60,166,995 (GRCm39)	missense	probably damaging	0.99
R9577:Cdh23	UTSW	10	60,146,895 (GRCm39)	missense	probably damaging	1.00
R9598:Cdh23	UTSW	10	60,214,574 (GRCm39)	missense	probably benign	0.01
R9631:Cdh23	UTSW	10	60,243,168 (GRCm39)	missense	possibly damaging	0.49
R9652:Cdh23	UTSW	10	60,167,135 (GRCm39)	missense	probably damaging	1.00
R9725:Cdh23	UTSW	10	60,432,561 (GRCm39)	missense	probably benign	0.02
X0052:Cdh23	UTSW	10	60,220,913 (GRCm39)	missense	probably damaging	1.00
Z1088:Cdh23	UTSW	10	60,249,423 (GRCm39)	missense	probably benign	0.35
Z1176:Cdh23	UTSW	10	60,264,100 (GRCm39)	missense	probably benign
Z1176:Cdh23	UTSW	10	60,146,549 (GRCm39)	missense	probably damaging	1.00
Z1177:Cdh23	UTSW	10	60,270,393 (GRCm39)	critical splice acceptor site	probably null
Z1177:Cdh23	UTSW	10	60,159,334 (GRCm39)	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- TGAACATATTAGGGACAGTCAGGAC -3'
(R):5'- CCAAGCTCTGGTTAGTAGGG -3'

Sequencing Primer
(F):5'- CCAATGGCTGCTATATGGCC -3'
(R):5'- CTCTGGTTAGTAGGGAGGGAGAG -3'

Posted On

2018-02-27