Incidental Mutation 'R6211:Qrich2'
ID503471
Institutional Source Beutler Lab
Gene Symbol Qrich2
Ensembl Gene ENSMUSG00000070331
Gene Nameglutamine rich 2
SynonymsLOC217341
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6211 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116441325-116466241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116453542 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1759 (D1759E)
Ref Sequence ENSEMBL: ENSMUSP00000147009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093909] [ENSMUST00000208602]
Predicted Effect probably benign
Transcript: ENSMUST00000093909
AA Change: D14E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091437
Gene: ENSMUSG00000070331
AA Change: D14E

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Pfam:DUF4795 97 304 3.7e-71 PFAM
low complexity region 471 491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134182
SMART Domains Protein: ENSMUSP00000115947
Gene: ENSMUSG00000070331

DomainStartEndE-ValueType
Blast:MYSc 1 287 4e-80 BLAST
coiled coil region 336 351 N/A INTRINSIC
low complexity region 602 622 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208602
AA Change: D1759E

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,239,004 H1035Q possibly damaging Het
Acin1 A T 14: 54,644,046 W391R probably damaging Het
Arl6ip1 A T 7: 118,127,250 S18R probably benign Het
Armc3 G A 2: 19,296,803 probably null Het
Casc1 C T 6: 145,200,491 R95Q probably damaging Het
Ccdc162 G T 10: 41,630,145 S883* probably null Het
Cd300lg A G 11: 102,054,169 M358V possibly damaging Het
Cdh23 A G 10: 60,410,821 V949A possibly damaging Het
Cenpo C T 12: 4,216,733 S126N probably benign Het
Chd3 A T 11: 69,352,677 D1366E probably damaging Het
Chd4 A G 6: 125,101,285 E169G possibly damaging Het
Clec1b A G 6: 129,401,477 T24A possibly damaging Het
Clhc1 A G 11: 29,578,145 I558V probably damaging Het
Col5a2 T A 1: 45,376,666 R1440S probably damaging Het
Cops3 A G 11: 59,817,901 probably benign Het
Cxcr4 A G 1: 128,589,450 V158A probably damaging Het
Dnah7a A G 1: 53,419,636 M3781T probably damaging Het
Elovl5 C A 9: 77,981,502 T217K probably damaging Het
Fbln7 G T 2: 128,895,340 M358I probably damaging Het
Fbxl13 C T 5: 21,484,021 R763Q possibly damaging Het
Gabrr3 C A 16: 59,448,108 N361K probably benign Het
Gbp7 A G 3: 142,545,993 M534V probably benign Het
Hcar2 G A 5: 123,864,954 T162I probably benign Het
Hdc A T 2: 126,593,977 L658Q probably damaging Het
Hivep3 A G 4: 120,098,405 Y1306C probably damaging Het
Homer3 C T 8: 70,285,524 R49C probably damaging Het
Hspa4 C T 11: 53,262,939 E702K probably benign Het
Iqgap3 A G 3: 88,091,515 N308D probably benign Het
Itga8 G A 2: 12,193,509 T555M probably damaging Het
Lrfn5 G T 12: 61,839,470 V15L probably benign Het
Lrrk1 T C 7: 66,302,710 K493E possibly damaging Het
Lyzl6 A G 11: 103,635,063 I77T probably damaging Het
Mavs G T 2: 131,240,391 R65L probably damaging Het
Mdn1 T G 4: 32,696,269 D1217E probably benign Het
Olfr103 A T 17: 37,336,708 F175I possibly damaging Het
Olfr1502 A G 19: 13,862,574 I260M probably benign Het
Olfr648 A T 7: 104,179,747 Y220* probably null Het
Otof C A 5: 30,371,900 V1762L probably damaging Het
Pcdha12 T C 18: 37,020,321 L31P probably damaging Het
Pxk C A 14: 8,163,952 P515T probably damaging Het
Rps6ka1 A T 4: 133,869,306 F33Y probably damaging Het
Rxfp2 G A 5: 150,044,126 probably null Het
Slc23a4 A T 6: 34,956,961 I202N probably damaging Het
Slc24a5 A T 2: 125,088,251 I491F probably benign Het
Slco1a1 T A 6: 141,909,049 K625N probably benign Het
Snx31 A G 15: 36,546,885 V51A probably damaging Het
Sox6 G T 7: 115,801,462 H48Q probably damaging Het
Tas2r109 A T 6: 132,980,624 Y114* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Timm13 A C 10: 80,900,480 probably null Het
Tpsb2 G A 17: 25,367,763 A250T possibly damaging Het
Trpm6 T C 19: 18,783,128 I131T probably damaging Het
Vars2 A T 17: 35,665,662 probably null Het
Vmn2r35 T A 7: 7,786,528 I737F probably damaging Het
Wdr46 C A 17: 33,944,485 T339K probably damaging Het
Other mutations in Qrich2
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4449:Qrich2 UTSW 11 116456199 small deletion probably benign
R0122:Qrich2 UTSW 11 116446813 missense possibly damaging 0.61
R0157:Qrich2 UTSW 11 116441395 missense probably damaging 1.00
R1479:Qrich2 UTSW 11 116441485 missense probably benign 0.08
R1786:Qrich2 UTSW 11 116441449 missense probably damaging 1.00
R2115:Qrich2 UTSW 11 116447156 missense probably damaging 0.99
R2130:Qrich2 UTSW 11 116448417 splice site probably benign
R2178:Qrich2 UTSW 11 116443777 missense probably damaging 1.00
R3875:Qrich2 UTSW 11 116445651 missense probably damaging 0.98
R4378:Qrich2 UTSW 11 116446915 missense probably damaging 1.00
R5124:Qrich2 UTSW 11 116446773 missense probably damaging 1.00
R5362:Qrich2 UTSW 11 116447150 missense probably damaging 1.00
R5468:Qrich2 UTSW 11 116448365 missense probably damaging 1.00
R5493:Qrich2 UTSW 11 116445948 critical splice donor site probably null
R5589:Qrich2 UTSW 11 116441408 missense probably damaging 1.00
R5696:Qrich2 UTSW 11 116445002 missense probably damaging 1.00
R6046:Qrich2 UTSW 11 116447006 intron probably benign
R6183:Qrich2 UTSW 11 116458129 unclassified probably benign
R6193:Qrich2 UTSW 11 116454153 missense probably benign 0.07
R6375:Qrich2 UTSW 11 116458228 unclassified probably benign
R6452:Qrich2 UTSW 11 116455888 missense probably benign 0.01
R6870:Qrich2 UTSW 11 116455330 missense probably damaging 0.96
R7073:Qrich2 UTSW 11 116446875 missense probably damaging 0.98
R7552:Qrich2 UTSW 11 116456254 missense possibly damaging 0.63
R7585:Qrich2 UTSW 11 116455721 missense probably benign 0.00
R7586:Qrich2 UTSW 11 116455624 missense probably benign 0.43
R7588:Qrich2 UTSW 11 116465937 missense possibly damaging 0.53
R7633:Qrich2 UTSW 11 116456629 missense unknown
R7638:Qrich2 UTSW 11 116455322 missense probably benign 0.00
R7736:Qrich2 UTSW 11 116457541 small deletion probably benign
R7737:Qrich2 UTSW 11 116457541 small deletion probably benign
R7753:Qrich2 UTSW 11 116457042 small deletion probably benign
R7800:Qrich2 UTSW 11 116456860 nonsense probably null
R7833:Qrich2 UTSW 11 116455765 missense probably benign 0.04
R7912:Qrich2 UTSW 11 116455782 small deletion probably benign
R7916:Qrich2 UTSW 11 116455765 missense probably benign 0.04
Z1176:Qrich2 UTSW 11 116456378 missense probably benign 0.00
Z1177:Qrich2 UTSW 11 116456668 missense unknown
Predicted Primers PCR Primer
(F):5'- AAATGTAGCCTGCCAGTCTC -3'
(R):5'- TTCTGAGCAAAGGGTTCTGG -3'

Sequencing Primer
(F):5'- CCGTGAAGGGCTAATCTTCTC -3'
(R):5'- CAAAGGGTTCTGGGCAGTG -3'
Posted On2018-02-27