Incidental Mutation 'R6212:Pgap1'
ID503484
Institutional Source Beutler Lab
Gene Symbol Pgap1
Ensembl Gene ENSMUSG00000073678
Gene Namepost-GPI attachment to proteins 1
SynonymsPGAP1, D230012E17Rik, oto, 5033403E17Rik, 9030223K07Rik
MMRRC Submission 044345-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.827) question?
Stock #R6212 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location54472994-54557684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54514893 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 457 (F457S)
Ref Sequence ENSEMBL: ENSMUSP00000095346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097739]
Predicted Effect probably damaging
Transcript: ENSMUST00000097739
AA Change: F457S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095346
Gene: ENSMUSG00000073678
AA Change: F457S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:PGAP1 82 302 7.2e-83 PFAM
transmembrane domain 597 619 N/A INTRINSIC
transmembrane domain 678 700 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
transmembrane domain 819 838 N/A INTRINSIC
low complexity region 854 866 N/A INTRINSIC
low complexity region 871 884 N/A INTRINSIC
transmembrane domain 902 921 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194316
Meta Mutation Damage Score 0.256 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions early in the glycosylphosphatidylinositol (GPI) biosynthetic pathway, catalyzing the inositol deacylation of GPI. The encoded protein is required for the production of GPI that can attach to proteins, and this may be an important factor in the transport of GPI-anchored proteins from the endoplasmic reticulum to the Golgi. Defects in this gene are a cause of mental retardation, autosomal recessive 42. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mutations in this gene result in a variety of forebrain, eye, jaw, craniofacial, ear, and vertebra defects that are background sensitive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,573,282 I116N probably damaging Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Ap3b1 C A 13: 94,493,699 H821N unknown Het
Apex1 C T 14: 50,926,893 P264S probably benign Het
Arhgap27 T C 11: 103,360,872 Y10C probably damaging Het
Bag6 A G 17: 35,140,302 T208A probably benign Het
Brd4 G T 17: 32,202,449 P771Q probably damaging Het
Capn3 A G 2: 120,477,186 S69G probably benign Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Celsr1 T C 15: 85,916,687 H2519R probably benign Het
Chd8 T A 14: 52,201,698 N48I probably damaging Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Dnhd1 C T 7: 105,704,048 P2803S probably damaging Het
Dusp26 G A 8: 31,094,224 D120N probably damaging Het
Epha6 T C 16: 60,425,356 H160R possibly damaging Het
Erg C T 16: 95,379,163 V215I probably damaging Het
Fam71f1 T C 6: 29,319,374 L59P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gabbr2 T C 4: 46,681,189 D124G probably damaging Het
Gapdh T C 6: 125,162,698 H203R probably damaging Het
Ggnbp2 T C 11: 84,836,677 M42V possibly damaging Het
Hk2 C A 6: 82,728,842 A827S probably benign Het
Hoxa5 T C 6: 52,202,714 E227G probably damaging Het
Itgax C A 7: 128,130,332 H31N possibly damaging Het
Itgax A G 7: 128,147,853 D942G probably benign Het
Kars A T 8: 112,000,197 probably null Het
Lama3 T C 18: 12,513,645 F1739L probably damaging Het
Map2k1 A T 9: 64,205,163 L155Q probably damaging Het
Mcf2l A T 8: 13,017,431 D1013V probably damaging Het
Mocs1 G A 17: 49,435,196 G118S probably damaging Het
Ncam2 T C 16: 81,432,762 S37P probably damaging Het
Nfxl1 A G 5: 72,516,210 probably null Het
Nodal C T 10: 61,423,521 H246Y possibly damaging Het
Nwd1 G A 8: 72,695,322 V999M possibly damaging Het
Oaz3 T A 3: 94,435,068 T139S probably benign Het
Olfr1347 T C 7: 6,488,368 probably null Het
Olfr58 A G 9: 19,783,289 D52G probably damaging Het
P3h3 T A 6: 124,845,643 T522S probably benign Het
Prkce T C 17: 86,559,301 Y530H probably damaging Het
Ptpn3 A T 4: 57,270,070 C31S probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Serpinb6e T A 13: 33,841,237 N24Y probably damaging Het
Slc4a8 T C 15: 100,811,571 V937A possibly damaging Het
Smgc T A 15: 91,850,627 probably benign Het
Srcap T A 7: 127,549,689 N2027K probably damaging Het
Stra6l T C 4: 45,884,664 Y565H probably benign Het
Tmem262 A G 19: 6,080,638 E62G possibly damaging Het
Tnrc6a T A 7: 123,143,742 probably null Het
Txlnb T C 10: 17,799,309 I70T probably damaging Het
Whrn A T 4: 63,494,686 L25* probably null Het
Zfp326 T A 5: 105,910,231 V412E probably damaging Het
Zfp831 A G 2: 174,645,868 R779G possibly damaging Het
Other mutations in Pgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Pgap1 APN 1 54492021 splice site probably benign
IGL01111:Pgap1 APN 1 54530943 missense probably benign 0.17
IGL01406:Pgap1 APN 1 54533414 splice site probably null
IGL01592:Pgap1 APN 1 54521311 missense probably damaging 1.00
IGL02005:Pgap1 APN 1 54551055 missense probably damaging 0.99
IGL02026:Pgap1 APN 1 54494819 missense probably benign 0.05
IGL02086:Pgap1 APN 1 54547988 missense probably damaging 1.00
IGL02354:Pgap1 APN 1 54512816 missense probably benign 0.02
IGL02361:Pgap1 APN 1 54512816 missense probably benign 0.02
IGL02995:Pgap1 APN 1 54493350 missense probably benign 0.19
IGL03012:Pgap1 APN 1 54533413 splice site probably benign
R0044:Pgap1 UTSW 1 54493368 missense probably damaging 1.00
R0109:Pgap1 UTSW 1 54494825 missense probably damaging 1.00
R0109:Pgap1 UTSW 1 54494825 missense probably damaging 1.00
R0241:Pgap1 UTSW 1 54535951 splice site probably null
R0241:Pgap1 UTSW 1 54535951 splice site probably null
R0352:Pgap1 UTSW 1 54486458 splice site probably benign
R1297:Pgap1 UTSW 1 54528523 missense possibly damaging 0.94
R1429:Pgap1 UTSW 1 54494861 missense probably benign 0.01
R1465:Pgap1 UTSW 1 54528555 missense probably benign 0.11
R1465:Pgap1 UTSW 1 54528555 missense probably benign 0.11
R1542:Pgap1 UTSW 1 54492090 missense probably benign 0.16
R1816:Pgap1 UTSW 1 54492057 missense probably damaging 0.99
R1817:Pgap1 UTSW 1 54535969 missense probably benign 0.15
R1905:Pgap1 UTSW 1 54511961 missense probably benign 0.26
R2006:Pgap1 UTSW 1 54551061 missense possibly damaging 0.76
R3551:Pgap1 UTSW 1 54530143 missense possibly damaging 0.89
R3833:Pgap1 UTSW 1 54557465 missense probably damaging 0.99
R3901:Pgap1 UTSW 1 54493348 missense probably benign
R4487:Pgap1 UTSW 1 54528592 missense probably benign 0.26
R4874:Pgap1 UTSW 1 54530137 missense probably damaging 0.96
R5184:Pgap1 UTSW 1 54481856 missense probably damaging 1.00
R6181:Pgap1 UTSW 1 54512777 missense probably benign 0.05
R6269:Pgap1 UTSW 1 54548008 nonsense probably null
R6525:Pgap1 UTSW 1 54481889 missense probably benign 0.00
R6944:Pgap1 UTSW 1 54530161 missense probably damaging 1.00
R7214:Pgap1 UTSW 1 54543061 missense possibly damaging 0.47
R7256:Pgap1 UTSW 1 54493207 critical splice donor site probably null
R7290:Pgap1 UTSW 1 54548066 missense possibly damaging 0.45
R7356:Pgap1 UTSW 1 54530134 missense probably benign 0.10
R7525:Pgap1 UTSW 1 54530922 missense probably benign 0.26
X0025:Pgap1 UTSW 1 54481870 missense probably benign 0.26
X0060:Pgap1 UTSW 1 54536034 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAACCTTCAACCTCAGAGGCTG -3'
(R):5'- AAGTGTTCTTGATGTAGTACCTGC -3'

Sequencing Primer
(F):5'- TTCAACCTCAGAGGCTGACAATC -3'
(R):5'- ACCTGCTTGGGAAATTGTGCC -3'
Posted On2018-02-27