Incidental Mutation 'R6212:Gabbr2'
ID503489
Institutional Source Beutler Lab
Gene Symbol Gabbr2
Ensembl Gene ENSMUSG00000039809
Gene Namegamma-aminobutyric acid (GABA) B receptor, 2
SynonymsGpr51, Gababr2, LOC242425
MMRRC Submission 044345-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R6212 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location46662305-46991873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46681189 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 124 (D124G)
Ref Sequence ENSEMBL: ENSMUSP00000146296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107749] [ENSMUST00000205643]
Predicted Effect probably damaging
Transcript: ENSMUST00000107749
AA Change: D714G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103378
Gene: ENSMUSG00000039809
AA Change: D714G

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:Peripla_BP_6 59 434 1.5e-15 PFAM
Pfam:ANF_receptor 75 429 2e-51 PFAM
Pfam:7tm_3 492 745 6.4e-57 PFAM
PDB:4PAS|B 778 818 1e-18 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129328
Predicted Effect probably damaging
Transcript: ENSMUST00000205643
AA Change: D124G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The multi-pass membrane protein encoded by this gene belongs to the G-protein coupled receptor 3 family and GABA-B receptor subfamily. The GABA-B receptors inhibit neuronal activity through G protein-coupled second-messenger systems, which regulate the release of neurotransmitters, and the activity of ion channels and adenylyl cyclase. This receptor subunit forms an active heterodimeric complex with GABA-B receptor subunit 1, neither of which is effective on its own. Allelic variants of this gene have been associated with nicotine dependence.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in clonic seizures, hyperactivity, hyperalgesia in response to thermal or mechanical stimuli, increased anxiety, and decreased depression-related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,573,282 I116N probably damaging Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Ap3b1 C A 13: 94,493,699 H821N unknown Het
Apex1 C T 14: 50,926,893 P264S probably benign Het
Arhgap27 T C 11: 103,360,872 Y10C probably damaging Het
Bag6 A G 17: 35,140,302 T208A probably benign Het
Brd4 G T 17: 32,202,449 P771Q probably damaging Het
Capn3 A G 2: 120,477,186 S69G probably benign Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Celsr1 T C 15: 85,916,687 H2519R probably benign Het
Chd8 T A 14: 52,201,698 N48I probably damaging Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Dnhd1 C T 7: 105,704,048 P2803S probably damaging Het
Dusp26 G A 8: 31,094,224 D120N probably damaging Het
Epha6 T C 16: 60,425,356 H160R possibly damaging Het
Erg C T 16: 95,379,163 V215I probably damaging Het
Fam71f1 T C 6: 29,319,374 L59P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gapdh T C 6: 125,162,698 H203R probably damaging Het
Ggnbp2 T C 11: 84,836,677 M42V possibly damaging Het
Hk2 C A 6: 82,728,842 A827S probably benign Het
Hoxa5 T C 6: 52,202,714 E227G probably damaging Het
Itgax C A 7: 128,130,332 H31N possibly damaging Het
Itgax A G 7: 128,147,853 D942G probably benign Het
Kars A T 8: 112,000,197 probably null Het
Lama3 T C 18: 12,513,645 F1739L probably damaging Het
Map2k1 A T 9: 64,205,163 L155Q probably damaging Het
Mcf2l A T 8: 13,017,431 D1013V probably damaging Het
Mocs1 G A 17: 49,435,196 G118S probably damaging Het
Ncam2 T C 16: 81,432,762 S37P probably damaging Het
Nfxl1 A G 5: 72,516,210 probably null Het
Nodal C T 10: 61,423,521 H246Y possibly damaging Het
Nwd1 G A 8: 72,695,322 V999M possibly damaging Het
Oaz3 T A 3: 94,435,068 T139S probably benign Het
Olfr1347 T C 7: 6,488,368 probably null Het
Olfr58 A G 9: 19,783,289 D52G probably damaging Het
P3h3 T A 6: 124,845,643 T522S probably benign Het
Pgap1 A G 1: 54,514,893 F457S probably damaging Het
Prkce T C 17: 86,559,301 Y530H probably damaging Het
Ptpn3 A T 4: 57,270,070 C31S probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Serpinb6e T A 13: 33,841,237 N24Y probably damaging Het
Slc4a8 T C 15: 100,811,571 V937A possibly damaging Het
Smgc T A 15: 91,850,627 probably benign Het
Srcap T A 7: 127,549,689 N2027K probably damaging Het
Stra6l T C 4: 45,884,664 Y565H probably benign Het
Tmem262 A G 19: 6,080,638 E62G possibly damaging Het
Tnrc6a T A 7: 123,143,742 probably null Het
Txlnb T C 10: 17,799,309 I70T probably damaging Het
Whrn A T 4: 63,494,686 L25* probably null Het
Zfp326 T A 5: 105,910,231 V412E probably damaging Het
Zfp831 A G 2: 174,645,868 R779G possibly damaging Het
Other mutations in Gabbr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Gabbr2 APN 4 46787600 missense probably damaging 1.00
IGL00844:Gabbr2 APN 4 46875711 missense probably damaging 1.00
IGL01584:Gabbr2 APN 4 46674524 missense probably damaging 0.97
IGL01684:Gabbr2 APN 4 46736501 missense probably benign
IGL01884:Gabbr2 APN 4 46875711 missense probably damaging 1.00
IGL02073:Gabbr2 APN 4 46667547 missense probably benign 0.00
IGL02376:Gabbr2 APN 4 46684300 missense probably damaging 1.00
R0194:Gabbr2 UTSW 4 46787565 missense possibly damaging 0.48
R0627:Gabbr2 UTSW 4 46681223 missense possibly damaging 0.92
R0685:Gabbr2 UTSW 4 46787521 missense possibly damaging 0.64
R0781:Gabbr2 UTSW 4 46718838 missense probably damaging 1.00
R0882:Gabbr2 UTSW 4 46718904 missense probably damaging 1.00
R0883:Gabbr2 UTSW 4 46677474 missense probably benign 0.00
R1004:Gabbr2 UTSW 4 46677544 missense possibly damaging 0.60
R1078:Gabbr2 UTSW 4 46664833 missense probably damaging 0.99
R1110:Gabbr2 UTSW 4 46718838 missense probably damaging 1.00
R1368:Gabbr2 UTSW 4 46674464 missense probably benign 0.31
R1557:Gabbr2 UTSW 4 46846436 missense probably damaging 1.00
R1577:Gabbr2 UTSW 4 46684319 missense probably benign 0.29
R1645:Gabbr2 UTSW 4 46664963 splice site probably null
R1743:Gabbr2 UTSW 4 46677603 missense possibly damaging 0.47
R1848:Gabbr2 UTSW 4 46739823 missense probably benign 0.31
R1997:Gabbr2 UTSW 4 46787502 missense probably damaging 1.00
R2009:Gabbr2 UTSW 4 46734119 missense probably damaging 1.00
R4021:Gabbr2 UTSW 4 46846435 missense probably damaging 1.00
R4719:Gabbr2 UTSW 4 46718797 missense probably damaging 0.99
R4757:Gabbr2 UTSW 4 46875675 missense probably damaging 0.98
R4798:Gabbr2 UTSW 4 46991139 missense possibly damaging 0.92
R5086:Gabbr2 UTSW 4 46724342 missense probably damaging 1.00
R5176:Gabbr2 UTSW 4 46681208 missense probably damaging 0.99
R5451:Gabbr2 UTSW 4 46684294 missense probably benign 0.15
R5510:Gabbr2 UTSW 4 46734113 missense probably damaging 1.00
R5611:Gabbr2 UTSW 4 46804105 missense probably damaging 0.98
R6049:Gabbr2 UTSW 4 46787641 missense probably damaging 1.00
R6089:Gabbr2 UTSW 4 46846448 missense probably damaging 1.00
R6118:Gabbr2 UTSW 4 46736459 missense probably damaging 1.00
R6209:Gabbr2 UTSW 4 46804069 missense probably damaging 1.00
R6717:Gabbr2 UTSW 4 46787574 missense possibly damaging 0.50
R7339:Gabbr2 UTSW 4 46846340 missense probably benign 0.01
R7479:Gabbr2 UTSW 4 46681166 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTAGGTATACACAAATGCACTTGC -3'
(R):5'- AGTAATGACTGACTCTCCTTTCTG -3'

Sequencing Primer
(F):5'- GCACATGCATGCACACAC -3'
(R):5'- GTTCACCATTTCAGTTGTTCGG -3'
Posted On2018-02-27