Incidental Mutation 'R6212:Zfp326'
ID503494
Institutional Source Beutler Lab
Gene Symbol Zfp326
Ensembl Gene ENSMUSG00000029290
Gene Namezinc finger protein 326
Synonyms5730470H14Rik, ZAN75
MMRRC Submission 044345-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R6212 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location105876565-105915818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105910231 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 412 (V412E)
Ref Sequence ENSEMBL: ENSMUSP00000031227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031227] [ENSMUST00000138615] [ENSMUST00000150440]
Predicted Effect probably damaging
Transcript: ENSMUST00000031227
AA Change: V412E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031227
Gene: ENSMUSG00000029290
AA Change: V412E

DomainStartEndE-ValueType
internal_repeat_1 19 39 1.09e-7 PROSPERO
internal_repeat_1 31 58 1.09e-7 PROSPERO
low complexity region 63 69 N/A INTRINSIC
low complexity region 154 162 N/A INTRINSIC
low complexity region 194 205 N/A INTRINSIC
coiled coil region 277 304 N/A INTRINSIC
ZnF_C2H2 312 336 4.12e0 SMART
ZnF_C2H2 405 430 1.78e2 SMART
low complexity region 483 561 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136558
Predicted Effect probably benign
Transcript: ENSMUST00000138615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147683
Predicted Effect probably damaging
Transcript: ENSMUST00000150440
AA Change: V323E

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118976
Gene: ENSMUSG00000029290
AA Change: V323E

DomainStartEndE-ValueType
internal_repeat_1 19 39 2.38e-7 PROSPERO
internal_repeat_1 31 58 2.38e-7 PROSPERO
low complexity region 63 73 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
coiled coil region 188 215 N/A INTRINSIC
ZnF_C2H2 223 247 4.12e0 SMART
ZnF_C2H2 316 341 1.78e2 SMART
low complexity region 389 415 N/A INTRINSIC
Meta Mutation Damage Score 0.0228 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,573,282 I116N probably damaging Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Ap3b1 C A 13: 94,493,699 H821N unknown Het
Apex1 C T 14: 50,926,893 P264S probably benign Het
Arhgap27 T C 11: 103,360,872 Y10C probably damaging Het
Bag6 A G 17: 35,140,302 T208A probably benign Het
Brd4 G T 17: 32,202,449 P771Q probably damaging Het
Capn3 A G 2: 120,477,186 S69G probably benign Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Celsr1 T C 15: 85,916,687 H2519R probably benign Het
Chd8 T A 14: 52,201,698 N48I probably damaging Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Dnhd1 C T 7: 105,704,048 P2803S probably damaging Het
Dusp26 G A 8: 31,094,224 D120N probably damaging Het
Epha6 T C 16: 60,425,356 H160R possibly damaging Het
Erg C T 16: 95,379,163 V215I probably damaging Het
Fam71f1 T C 6: 29,319,374 L59P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gabbr2 T C 4: 46,681,189 D124G probably damaging Het
Gapdh T C 6: 125,162,698 H203R probably damaging Het
Ggnbp2 T C 11: 84,836,677 M42V possibly damaging Het
Hk2 C A 6: 82,728,842 A827S probably benign Het
Hoxa5 T C 6: 52,202,714 E227G probably damaging Het
Itgax C A 7: 128,130,332 H31N possibly damaging Het
Itgax A G 7: 128,147,853 D942G probably benign Het
Kars A T 8: 112,000,197 probably null Het
Lama3 T C 18: 12,513,645 F1739L probably damaging Het
Map2k1 A T 9: 64,205,163 L155Q probably damaging Het
Mcf2l A T 8: 13,017,431 D1013V probably damaging Het
Mocs1 G A 17: 49,435,196 G118S probably damaging Het
Ncam2 T C 16: 81,432,762 S37P probably damaging Het
Nfxl1 A G 5: 72,516,210 probably null Het
Nodal C T 10: 61,423,521 H246Y possibly damaging Het
Nwd1 G A 8: 72,695,322 V999M possibly damaging Het
Oaz3 T A 3: 94,435,068 T139S probably benign Het
Olfr1347 T C 7: 6,488,368 probably null Het
Olfr58 A G 9: 19,783,289 D52G probably damaging Het
P3h3 T A 6: 124,845,643 T522S probably benign Het
Pgap1 A G 1: 54,514,893 F457S probably damaging Het
Prkce T C 17: 86,559,301 Y530H probably damaging Het
Ptpn3 A T 4: 57,270,070 C31S probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Serpinb6e T A 13: 33,841,237 N24Y probably damaging Het
Slc4a8 T C 15: 100,811,571 V937A possibly damaging Het
Smgc T A 15: 91,850,627 probably benign Het
Srcap T A 7: 127,549,689 N2027K probably damaging Het
Stra6l T C 4: 45,884,664 Y565H probably benign Het
Tmem262 A G 19: 6,080,638 E62G possibly damaging Het
Tnrc6a T A 7: 123,143,742 probably null Het
Txlnb T C 10: 17,799,309 I70T probably damaging Het
Whrn A T 4: 63,494,686 L25* probably null Het
Zfp831 A G 2: 174,645,868 R779G possibly damaging Het
Other mutations in Zfp326
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Zfp326 APN 5 105907045 missense possibly damaging 0.89
IGL00432:Zfp326 APN 5 105896533 missense probably damaging 0.98
IGL01551:Zfp326 APN 5 105888585 missense probably damaging 1.00
IGL03197:Zfp326 APN 5 105891193 missense probably benign 0.00
PIT4508001:Zfp326 UTSW 5 105914690 missense probably benign 0.02
R0326:Zfp326 UTSW 5 105910275 missense probably damaging 1.00
R0411:Zfp326 UTSW 5 105878775 missense possibly damaging 0.81
R0634:Zfp326 UTSW 5 105886203 nonsense probably null
R0850:Zfp326 UTSW 5 105878797 splice site probably null
R1833:Zfp326 UTSW 5 105891169 nonsense probably null
R2108:Zfp326 UTSW 5 105914780 utr 3 prime probably benign
R2857:Zfp326 UTSW 5 105888529 missense probably benign 0.11
R3702:Zfp326 UTSW 5 105888843 splice site probably null
R4690:Zfp326 UTSW 5 105907076 missense probably damaging 1.00
R5614:Zfp326 UTSW 5 105888495 missense probably damaging 1.00
R6262:Zfp326 UTSW 5 105888487 missense probably damaging 1.00
R6274:Zfp326 UTSW 5 105905980 missense probably damaging 1.00
R6439:Zfp326 UTSW 5 105888718 missense probably null 0.69
R6963:Zfp326 UTSW 5 105911493 nonsense probably null
Z1088:Zfp326 UTSW 5 105888630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACATGAGGTGTGCAGAACTTG -3'
(R):5'- TCTGTCTCTAAGCTGACACATAAC -3'

Sequencing Primer
(F):5'- TGTGCAGAACTTGACCCATG -3'
(R):5'- GCTGACACATAACTAGCTGTTC -3'
Posted On2018-02-27