Incidental Mutation 'R6212:Ncam2'
ID503529
Institutional Source Beutler Lab
Gene Symbol Ncam2
Ensembl Gene ENSMUSG00000022762
Gene Nameneural cell adhesion molecule 2
SynonymsOcam, RNCAM, Ncam-2, R4B12 antigen
MMRRC Submission 044345-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6212 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location81200697-81626828 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81432762 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 37 (S37P)
Ref Sequence ENSEMBL: ENSMUSP00000063468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037785] [ENSMUST00000067602]
Predicted Effect probably damaging
Transcript: ENSMUST00000037785
AA Change: S37P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049390
Gene: ENSMUSG00000022762
AA Change: S37P

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
IGc2 33 100 3.18e-6 SMART
IGc2 127 193 1.13e-11 SMART
IGc2 223 288 2.03e-13 SMART
IGc2 313 387 1.12e-15 SMART
IGc2 413 482 9.93e-8 SMART
FN3 496 578 5.91e-13 SMART
FN3 594 675 2.87e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000067602
AA Change: S37P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063468
Gene: ENSMUSG00000022762
AA Change: S37P

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
IGc2 33 100 3.18e-6 SMART
IGc2 127 193 1.13e-11 SMART
IGc2 223 288 2.03e-13 SMART
IGc2 313 387 1.12e-15 SMART
IGc2 413 482 9.93e-8 SMART
FN3 496 578 5.91e-13 SMART
FN3 594 675 2.87e-2 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 741 757 N/A INTRINSIC
low complexity region 789 812 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231687
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the immunoglobulin superfamily. It is a type I membrane protein and may function in selective fasciculation and zone-to-zone projection of the primary olfactory axons. [provided by RefSeq, Jul 2008]
PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. Mice homozygous for a knock-out allele exhibit exhibit increased proliferation rate and clonogenic frequency in spinal cord-derived neurospheres. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,573,282 I116N probably damaging Het
Ap3b1 T C 13: 94,451,073 S452P probably damaging Het
Ap3b1 C A 13: 94,493,699 H821N unknown Het
Apex1 C T 14: 50,926,893 P264S probably benign Het
Arhgap27 T C 11: 103,360,872 Y10C probably damaging Het
Bag6 A G 17: 35,140,302 T208A probably benign Het
Brd4 G T 17: 32,202,449 P771Q probably damaging Het
Capn3 A G 2: 120,477,186 S69G probably benign Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Celsr1 T C 15: 85,916,687 H2519R probably benign Het
Chd8 T A 14: 52,201,698 N48I probably damaging Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Dnhd1 C T 7: 105,704,048 P2803S probably damaging Het
Dusp26 G A 8: 31,094,224 D120N probably damaging Het
Epha6 T C 16: 60,425,356 H160R possibly damaging Het
Erg C T 16: 95,379,163 V215I probably damaging Het
Fam71f1 T C 6: 29,319,374 L59P probably damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gabbr2 T C 4: 46,681,189 D124G probably damaging Het
Gapdh T C 6: 125,162,698 H203R probably damaging Het
Ggnbp2 T C 11: 84,836,677 M42V possibly damaging Het
Hk2 C A 6: 82,728,842 A827S probably benign Het
Hoxa5 T C 6: 52,202,714 E227G probably damaging Het
Itgax C A 7: 128,130,332 H31N possibly damaging Het
Itgax A G 7: 128,147,853 D942G probably benign Het
Kars A T 8: 112,000,197 probably null Het
Lama3 T C 18: 12,513,645 F1739L probably damaging Het
Map2k1 A T 9: 64,205,163 L155Q probably damaging Het
Mcf2l A T 8: 13,017,431 D1013V probably damaging Het
Mocs1 G A 17: 49,435,196 G118S probably damaging Het
Nfxl1 A G 5: 72,516,210 probably null Het
Nodal C T 10: 61,423,521 H246Y possibly damaging Het
Nwd1 G A 8: 72,695,322 V999M possibly damaging Het
Oaz3 T A 3: 94,435,068 T139S probably benign Het
Olfr1347 T C 7: 6,488,368 probably null Het
Olfr58 A G 9: 19,783,289 D52G probably damaging Het
P3h3 T A 6: 124,845,643 T522S probably benign Het
Pgap1 A G 1: 54,514,893 F457S probably damaging Het
Prkce T C 17: 86,559,301 Y530H probably damaging Het
Ptpn3 A T 4: 57,270,070 C31S probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Serpinb6e T A 13: 33,841,237 N24Y probably damaging Het
Slc4a8 T C 15: 100,811,571 V937A possibly damaging Het
Smgc T A 15: 91,850,627 probably benign Het
Srcap T A 7: 127,549,689 N2027K probably damaging Het
Stra6l T C 4: 45,884,664 Y565H probably benign Het
Tmem262 A G 19: 6,080,638 E62G possibly damaging Het
Tnrc6a T A 7: 123,143,742 probably null Het
Txlnb T C 10: 17,799,309 I70T probably damaging Het
Whrn A T 4: 63,494,686 L25* probably null Het
Zfp326 T A 5: 105,910,231 V412E probably damaging Het
Zfp831 A G 2: 174,645,868 R779G possibly damaging Het
Other mutations in Ncam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Ncam2 APN 16 81517579 missense probably damaging 1.00
IGL01369:Ncam2 APN 16 81461571 missense probably benign 0.09
IGL01554:Ncam2 APN 16 81512935 missense possibly damaging 0.88
IGL01892:Ncam2 APN 16 81589699 missense possibly damaging 0.71
IGL02320:Ncam2 APN 16 81434837 missense probably damaging 0.99
IGL02669:Ncam2 APN 16 81517541 missense probably benign 0.18
IGL03073:Ncam2 APN 16 81621347 missense possibly damaging 0.70
IGL03353:Ncam2 APN 16 81434900 missense probably benign 0.04
R0087:Ncam2 UTSW 16 81434901 missense probably benign 0.11
R0097:Ncam2 UTSW 16 81517537 missense probably damaging 1.00
R0276:Ncam2 UTSW 16 81517629 splice site probably benign
R0279:Ncam2 UTSW 16 81623337 splice site probably benign
R0471:Ncam2 UTSW 16 81200884 start gained probably benign
R0523:Ncam2 UTSW 16 81461643 missense probably damaging 0.99
R1353:Ncam2 UTSW 16 81200915 start codon destroyed probably null
R1646:Ncam2 UTSW 16 81465706 critical splice donor site probably benign
R1884:Ncam2 UTSW 16 81437683 missense probably damaging 1.00
R2002:Ncam2 UTSW 16 81589698 missense possibly damaging 0.70
R2157:Ncam2 UTSW 16 81490389 missense probably damaging 1.00
R2330:Ncam2 UTSW 16 81512921 missense probably benign 0.17
R2404:Ncam2 UTSW 16 81490240 splice site probably benign
R2434:Ncam2 UTSW 16 81595225 missense probably benign 0.01
R3104:Ncam2 UTSW 16 81465710 splice site probably benign
R3842:Ncam2 UTSW 16 81434810 missense probably damaging 1.00
R3954:Ncam2 UTSW 16 81589724 missense probably damaging 1.00
R4039:Ncam2 UTSW 16 81490323 missense probably benign 0.02
R4210:Ncam2 UTSW 16 81527103 missense probably benign 0.02
R4514:Ncam2 UTSW 16 81512996 missense probably benign 0.13
R4583:Ncam2 UTSW 16 81517557 missense probably damaging 1.00
R4586:Ncam2 UTSW 16 81465569 missense probably benign 0.06
R4710:Ncam2 UTSW 16 81465706 critical splice donor site probably null
R4732:Ncam2 UTSW 16 81434884 missense possibly damaging 0.63
R4733:Ncam2 UTSW 16 81434884 missense possibly damaging 0.63
R4876:Ncam2 UTSW 16 81490346 missense probably benign 0.27
R4923:Ncam2 UTSW 16 81589791 missense possibly damaging 0.48
R5131:Ncam2 UTSW 16 81437662 missense probably benign 0.44
R5329:Ncam2 UTSW 16 81434819 missense probably damaging 1.00
R5478:Ncam2 UTSW 16 81434878 nonsense probably null
R5479:Ncam2 UTSW 16 81434878 nonsense probably null
R5481:Ncam2 UTSW 16 81434878 nonsense probably null
R5519:Ncam2 UTSW 16 81434878 nonsense probably null
R5522:Ncam2 UTSW 16 81434878 nonsense probably null
R5523:Ncam2 UTSW 16 81434878 nonsense probably null
R5524:Ncam2 UTSW 16 81434878 nonsense probably null
R5526:Ncam2 UTSW 16 81434878 nonsense probably null
R5718:Ncam2 UTSW 16 81589814 splice site probably null
R5793:Ncam2 UTSW 16 81576103 missense possibly damaging 0.95
R6050:Ncam2 UTSW 16 81443166 nonsense probably null
R6847:Ncam2 UTSW 16 81432718 missense probably damaging 1.00
R6935:Ncam2 UTSW 16 81526991 missense probably benign 0.24
R7159:Ncam2 UTSW 16 81490374 missense probably damaging 1.00
R7193:Ncam2 UTSW 16 81589795 missense probably damaging 1.00
R7232:Ncam2 UTSW 16 81512871 missense probably damaging 1.00
R7346:Ncam2 UTSW 16 81623368 missense probably damaging 1.00
R7568:Ncam2 UTSW 16 81589801 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GCTGGTAGTAAATGCACACAACTC -3'
(R):5'- GGGTTCAAATTAATCCTAGTATGGC -3'

Sequencing Primer
(F):5'- GGTAGTAAATGCACACAACTCTAGTG -3'
(R):5'- TCTTAGGTACAGATTGCATTT -3'
Posted On2018-02-27