Mutagenetix > Incidental Mutation

Incidental Mutation 'R6213:Muc2'

503561

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

044346-MU

Accession Numbers

Genbank: BC034197; MGI: 1339364

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R6213 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

141690340-141754693 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 141751414 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 152 (C152R)

Ref Sequence

ENSEMBL: ENSMUSP00000026590 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026590]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000026590
AA Change: C152R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000026590
Gene: ENSMUSG00000025515
AA Change: C152R

Domain	Start	End	E-Value	Type
C8	1	63	1.65e-11	SMART
VWC	120	188	5.48e-2	SMART
VWC	229	293	2.38e-11	SMART
Blast:VWD	299	363	4e-17	BLAST
CT	380	463	3.6e-35	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000187945
AA Change: C591R

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	A	G	16: 20,400,012	Y207H	probably damaging	Het
Adcy7	G	A	8: 88,314,137	V335M	probably damaging	Het
Apol11b	A	C	15: 77,638,000	D32E	possibly damaging	Het
Ccdc13	A	G	9: 121,798,909		probably benign	Het
Cdkn1b	T	A	6: 134,921,243	D108E	probably benign	Het
Cep290	A	G	10: 100,523,360	D984G	probably benign	Het
Csde1	T	C	3: 103,040,514	V128A	probably damaging	Het
Csmd3	A	G	15: 47,629,260	S3162P	probably damaging	Het
D5Ertd579e	G	A	5: 36,602,634	T1394I	probably damaging	Het
Ddx6	T	A	9: 44,628,693	L306Q	probably damaging	Het
Dmxl1	T	A	18: 49,863,015	S403T	possibly damaging	Het
F11	G	T	8: 45,241,500	T608K	probably damaging	Het
Flrt3	C	T	2: 140,661,165	R181H	probably damaging	Het
Hs3st1	A	T	5: 39,614,521	C260S	probably damaging	Het
Ighv7-1	A	T	12: 113,896,521	S84T	probably damaging	Het
Inpp4b	A	G	8: 81,997,390	D332G	probably damaging	Het
Irf2bpl	T	C	12: 86,883,593	Q102R	probably benign	Het
Itpr3	T	A	17: 27,111,200	D1597E	probably benign	Het
Kcnd1	G	C	X: 7,823,909	A23P	probably damaging	Homo
Lypd8	A	G	11: 58,390,334	T241A	probably benign	Het
Map1lc3a	T	C	2: 155,277,015		probably null	Het
Mast1	G	A	8: 84,915,569	T1052I	probably damaging	Het
Muc5b	A	T	7: 141,862,166	M2950L	probably benign	Het
Muc5b	A	G	7: 141,867,619	D4282G	possibly damaging	Het
Myo16	G	T	8: 10,370,963		probably null	Het
Myo9a	T	A	9: 59,827,258	F708I	probably damaging	Het
Nadsyn1	A	T	7: 143,799,812	F558Y	probably benign	Het
Nat9	A	T	11: 115,185,106	W30R	probably damaging	Het
Nipbl	A	G	15: 8,334,906	L1338S	probably damaging	Het
Nipsnap3b	A	G	4: 53,017,066	T97A	probably benign	Het
Npepps	A	T	11: 97,241,997	Y301*	probably null	Het
Nrcam	C	T	12: 44,562,432	P447S	possibly damaging	Het
Olfr237-ps1	A	G	6: 43,153,887	N194S	possibly damaging	Het
Olfr295	A	G	7: 86,585,277	M1V	probably null	Het
Olfr547	T	C	7: 102,534,932	Y62H	probably damaging	Het
Olfr99	T	C	17: 37,280,373	S16G	probably benign	Het
Pacsin3	G	T	2: 91,260,434	V29F	probably damaging	Het
Pdzrn3	A	C	6: 101,377,844	D15E	probably damaging	Het
Phf20l1	T	C	15: 66,632,903		probably null	Het
Pign	A	C	1: 105,589,266	V545G	possibly damaging	Het
Pkhd1	T	C	1: 20,523,770	N1373S	possibly damaging	Het
Ptchd4	T	A	17: 42,377,360	H264Q	probably benign	Het
Ptpn3	G	T	4: 57,265,012	Q73K	probably damaging	Het
Ptrh1	G	A	2: 32,776,745	V109I	probably benign	Het
Reg1	A	T	6: 78,427,403	I87F	possibly damaging	Het
Rrp12	C	A	19: 41,868,778	V1186L	probably benign	Het
Sall1	AGTGGTGGTGGTGGTGGTGGTGG	AGTGGTGGTGGTGGTGGTGG	8: 89,033,058		probably benign	Het
Slc23a3	A	C	1: 75,131,748	F279V	probably benign	Het
Smtnl2	G	A	11: 72,401,399	A274V	probably damaging	Het
Suds3	A	G	5: 117,106,662	L115P	probably damaging	Het
Tekt2	G	A	4: 126,323,196	A260V	probably damaging	Het
Tgfb3	T	A	12: 86,057,847	Y391F	probably damaging	Het
Topbp1	T	C	9: 103,332,751	S866P	probably benign	Het
Tspan14	A	G	14: 40,913,415	Y175H	probably benign	Het
Vars2	T	C	17: 35,660,440	T568A	probably benign	Het
Vmn1r216	T	G	13: 23,099,169	D7E	probably benign	Het
Vmn2r115	ATCTTCT	ATCT	17: 23,359,988		probably benign	Het
Zfp281	T	C	1: 136,625,512	V76A	probably benign	Het
Zfp36l2	T	C	17: 84,186,552	N219S	probably damaging	Het
Zfp626	T	C	7: 27,808,292	M42T	probably benign	Het
Zscan21	C	T	5: 138,125,097	P13S	probably benign	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141693356	missense	probably benign	0.35
kenny	APN	7		nonsense
Winnie	APN	7	141699460	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141752395	missense	probably benign
IGL01482:Muc2	APN	7	141754060	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141752740	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141751504	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141751872	nonsense	probably null
IGL02548:Muc2	APN	7	141751857	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141746713	unclassified	probably benign
IGL03196:Muc2	APN	7	141747630	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141753439	missense	unknown
nomoco	UTSW	7	141753719	missense	probably damaging	1.00
Schlendrian	UTSW	7	141695682	missense	probably damaging	1.00
Seco	UTSW	7	141698733	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141696355	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141748954	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141748971	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141699185	frame shift	probably null
R0299:Muc2	UTSW	7	141752729	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141699185	frame shift	probably null
R0699:Muc2	UTSW	7	141752300	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141699185	frame shift	probably null
R1348:Muc2	UTSW	7	141699185	frame shift	probably null
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141697162	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141700875	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141699185	frame shift	probably null
R2163:Muc2	UTSW	7	141699185	frame shift	probably null
R3008:Muc2	UTSW	7	141695104	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141745488	unclassified	probably benign
R3112:Muc2	UTSW	7	141745488	unclassified	probably benign
R3424:Muc2	UTSW	7	141693352	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141697347	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141754344	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141746804	unclassified	probably benign
R3974:Muc2	UTSW	7	141746804	unclassified	probably benign
R3976:Muc2	UTSW	7	141746804	unclassified	probably benign
R4327:Muc2	UTSW	7	141695334	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141752345	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141745608	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141699691	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141754140	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141749543	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141753719	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141751432	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141691203	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141745644	unclassified	probably benign
R5919:Muc2	UTSW	7	141694928	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141701382	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141697250	splice site	probably null
R5979:Muc2	UTSW	7	141751406	missense	probably damaging	0.99
R6175:Muc2	UTSW	7	141696632	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141752403	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141700828	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141752146	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141746736	unclassified	probably benign
R6582:Muc2	UTSW	7	141696698	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141751477	missense	probably benign	0.38
R6896:Muc2	UTSW	7	141752695	missense	possibly damaging	0.48
R6906:Muc2	UTSW	7	141698733	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141697834	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141751457	missense	unknown
R7222:Muc2	UTSW	7	141704209	missense
R7251:Muc2	UTSW	7	141692722	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141752744	missense
R7315:Muc2	UTSW	7	141690402	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141748126	missense
R7556:Muc2	UTSW	7	141753702	missense
R7651:Muc2	UTSW	7	141704201	missense
R7710:Muc2	UTSW	7	141700883	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141704393	missense
R7813:Muc2	UTSW	7	141696300	splice site	probably null
R7843:Muc2	UTSW	7	141695419	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141749734	missense
R7924:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
R7993:Muc2	UTSW	7	141754436	missense
R8053:Muc2	UTSW	7	141698332	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141744685	missense
R8099:Muc2	UTSW	7	141745438	splice site	probably null
R8192:Muc2	UTSW	7	141751478	missense
R8194:Muc2	UTSW	7	141704252	missense
R8545:Muc2	UTSW	7	141752393	missense	unknown
R8701:Muc2	UTSW	7	141695607	missense	probably damaging	1.00
R8883:Muc2	UTSW	7	141700900	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141694515	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141693400	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141701367	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9085:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141704267	missense
R9104:Muc2	UTSW	7	141699655	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141701414	nonsense	probably null
R9270:Muc2	UTSW	7	141704267	missense
R9297:Muc2	UTSW	7	141749022	missense
R9325:Muc2	UTSW	7	141744822	missense
R9354:Muc2	UTSW	7	141753420	missense
R9386:Muc2	UTSW	7	141693146	missense	probably damaging	1.00
R9529:Muc2	UTSW	7	141700884	missense	possibly damaging	0.55
R9550:Muc2	UTSW	7	141754505	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141746822	missense
R9607:Muc2	UTSW	7	141751453	missense
R9646:Muc2	UTSW	7	141690400	missense	probably benign
R9651:Muc2	UTSW	7	141701445	missense	probably damaging	0.99
R9774:Muc2	UTSW	7	141699242	missense	probably benign
R9784:Muc2	UTSW	7	141694542	nonsense	probably null
Z1176:Muc2	UTSW	7	141746714	missense
Z1177:Muc2	UTSW	7	141744794	missense

Predicted Primers

PCR Primer
(F):5'- CCCTTGAATGAACAGTTGCTG -3'
(R):5'- AGTGGGCATGTTTGACTCAC -3'

Sequencing Primer
(F):5'- GAACAGTTGCTGGTCTGTCCC -3'
(R):5'- GGCATGTTTGACTCACTAGGAAC -3'

Posted On

2018-02-27