Incidental Mutation 'R6213:Myo16'
ID503565
Institutional Source Beutler Lab
Gene Symbol Myo16
Ensembl Gene ENSMUSG00000039057
Gene Namemyosin XVI
SynonymsBM140241, C230040D10Rik, Nyap3
MMRRC Submission 044346-MU
Accession Numbers

Genbank: NM_001081397; MGI: 2685951

Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R6213 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location10153911-10634742 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 10370963 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042103] [ENSMUST00000042103] [ENSMUST00000207204] [ENSMUST00000207204] [ENSMUST00000207477] [ENSMUST00000207477] [ENSMUST00000208309] [ENSMUST00000208309] [ENSMUST00000214643]
Predicted Effect probably null
Transcript: ENSMUST00000042103
SMART Domains Protein: ENSMUSP00000049345
Gene: ENSMUSG00000039057

DomainStartEndE-ValueType
ANK 92 121 1.65e-1 SMART
ANK 125 154 3.46e-4 SMART
ANK 158 189 2.11e2 SMART
ANK 221 250 2.85e-5 SMART
ANK 254 283 3.51e-5 SMART
low complexity region 333 349 N/A INTRINSIC
MYSc 394 1144 2.27e-144 SMART
IQ 1144 1166 4.06e-2 SMART
Pfam:NYAP_N 1207 1591 4.1e-135 PFAM
low complexity region 1670 1690 N/A INTRINSIC
low complexity region 1841 1860 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000042103
SMART Domains Protein: ENSMUSP00000049345
Gene: ENSMUSG00000039057

DomainStartEndE-ValueType
ANK 92 121 1.65e-1 SMART
ANK 125 154 3.46e-4 SMART
ANK 158 189 2.11e2 SMART
ANK 221 250 2.85e-5 SMART
ANK 254 283 3.51e-5 SMART
low complexity region 333 349 N/A INTRINSIC
MYSc 394 1144 2.27e-144 SMART
IQ 1144 1166 4.06e-2 SMART
Pfam:NYAP_N 1207 1591 4.1e-135 PFAM
low complexity region 1670 1690 N/A INTRINSIC
low complexity region 1841 1860 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000207204
Predicted Effect probably null
Transcript: ENSMUST00000207204
Predicted Effect probably null
Transcript: ENSMUST00000207477
Predicted Effect probably null
Transcript: ENSMUST00000207477
Predicted Effect probably null
Transcript: ENSMUST00000208309
Predicted Effect probably null
Transcript: ENSMUST00000208309
Predicted Effect probably benign
Transcript: ENSMUST00000214643
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A G 16: 20,400,012 Y207H probably damaging Het
Adcy7 G A 8: 88,314,137 V335M probably damaging Het
Apol11b A C 15: 77,638,000 D32E possibly damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdkn1b T A 6: 134,921,243 D108E probably benign Het
Cep290 A G 10: 100,523,360 D984G probably benign Het
Csde1 T C 3: 103,040,514 V128A probably damaging Het
Csmd3 A G 15: 47,629,260 S3162P probably damaging Het
D5Ertd579e G A 5: 36,602,634 T1394I probably damaging Het
Ddx6 T A 9: 44,628,693 L306Q probably damaging Het
Dmxl1 T A 18: 49,863,015 S403T possibly damaging Het
F11 G T 8: 45,241,500 T608K probably damaging Het
Flrt3 C T 2: 140,661,165 R181H probably damaging Het
Hs3st1 A T 5: 39,614,521 C260S probably damaging Het
Ighv7-1 A T 12: 113,896,521 S84T probably damaging Het
Inpp4b A G 8: 81,997,390 D332G probably damaging Het
Irf2bpl T C 12: 86,883,593 Q102R probably benign Het
Itpr3 T A 17: 27,111,200 D1597E probably benign Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Lypd8 A G 11: 58,390,334 T241A probably benign Het
Map1lc3a T C 2: 155,277,015 probably null Het
Mast1 G A 8: 84,915,569 T1052I probably damaging Het
Muc2 T C 7: 141,751,414 C152R probably damaging Het
Muc5b A T 7: 141,862,166 M2950L probably benign Het
Muc5b A G 7: 141,867,619 D4282G possibly damaging Het
Myo9a T A 9: 59,827,258 F708I probably damaging Het
Nadsyn1 A T 7: 143,799,812 F558Y probably benign Het
Nat9 A T 11: 115,185,106 W30R probably damaging Het
Nipbl A G 15: 8,334,906 L1338S probably damaging Het
Nipsnap3b A G 4: 53,017,066 T97A probably benign Het
Npepps A T 11: 97,241,997 Y301* probably null Het
Nrcam C T 12: 44,562,432 P447S possibly damaging Het
Olfr237-ps1 A G 6: 43,153,887 N194S possibly damaging Het
Olfr295 A G 7: 86,585,277 M1V probably null Het
Olfr547 T C 7: 102,534,932 Y62H probably damaging Het
Olfr99 T C 17: 37,280,373 S16G probably benign Het
Pacsin3 G T 2: 91,260,434 V29F probably damaging Het
Pdzrn3 A C 6: 101,377,844 D15E probably damaging Het
Phf20l1 T C 15: 66,632,903 probably null Het
Pign A C 1: 105,589,266 V545G possibly damaging Het
Pkhd1 T C 1: 20,523,770 N1373S possibly damaging Het
Ptchd4 T A 17: 42,377,360 H264Q probably benign Het
Ptpn3 G T 4: 57,265,012 Q73K probably damaging Het
Ptrh1 G A 2: 32,776,745 V109I probably benign Het
Reg1 A T 6: 78,427,403 I87F possibly damaging Het
Rrp12 C A 19: 41,868,778 V1186L probably benign Het
Sall1 AGTGGTGGTGGTGGTGGTGGTGG AGTGGTGGTGGTGGTGGTGG 8: 89,033,058 probably benign Het
Slc23a3 A C 1: 75,131,748 F279V probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Suds3 A G 5: 117,106,662 L115P probably damaging Het
Tekt2 G A 4: 126,323,196 A260V probably damaging Het
Tgfb3 T A 12: 86,057,847 Y391F probably damaging Het
Topbp1 T C 9: 103,332,751 S866P probably benign Het
Tspan14 A G 14: 40,913,415 Y175H probably benign Het
Vars2 T C 17: 35,660,440 T568A probably benign Het
Vmn1r216 T G 13: 23,099,169 D7E probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zfp281 T C 1: 136,625,512 V76A probably benign Het
Zfp36l2 T C 17: 84,186,552 N219S probably damaging Het
Zfp626 T C 7: 27,808,292 M42T probably benign Het
Zscan21 C T 5: 138,125,097 P13S probably benign Het
Other mutations in Myo16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Myo16 APN 8 10438889 missense probably damaging 1.00
IGL00567:Myo16 APN 8 10462154 missense probably damaging 1.00
IGL00671:Myo16 APN 8 10361067 missense probably damaging 1.00
IGL00897:Myo16 APN 8 10315518 missense probably damaging 1.00
IGL01458:Myo16 APN 8 10435853 missense probably damaging 1.00
IGL01523:Myo16 APN 8 10370908 missense probably damaging 1.00
IGL01532:Myo16 APN 8 10400551 missense probably benign 0.00
IGL01680:Myo16 APN 8 10272630 missense probably damaging 1.00
IGL01747:Myo16 APN 8 10604877 missense probably damaging 1.00
IGL02084:Myo16 APN 8 10361088 missense probably damaging 0.99
IGL02203:Myo16 APN 8 10570132 missense possibly damaging 0.52
IGL02506:Myo16 APN 8 10390217 missense probably damaging 1.00
IGL02819:Myo16 APN 8 10322600 missense probably damaging 1.00
IGL02935:Myo16 APN 8 10532990 missense probably benign 0.41
IGL02943:Myo16 APN 8 10400595 splice site probably benign
IGL03347:Myo16 APN 8 10376120 critical splice acceptor site probably null
3-1:Myo16 UTSW 8 10438869 missense probably damaging 0.99
P0016:Myo16 UTSW 8 10400596 splice site probably benign
R0006:Myo16 UTSW 8 10475988 missense probably damaging 0.98
R0006:Myo16 UTSW 8 10475988 missense probably damaging 0.98
R0033:Myo16 UTSW 8 10370955 missense probably damaging 1.00
R0033:Myo16 UTSW 8 10370955 missense probably damaging 1.00
R0142:Myo16 UTSW 8 10569790 missense probably benign 0.01
R0195:Myo16 UTSW 8 10315538 splice site probably benign
R0418:Myo16 UTSW 8 10569918 missense probably benign 0.01
R0576:Myo16 UTSW 8 10562318 critical splice donor site probably null
R0627:Myo16 UTSW 8 10439689 missense probably benign 0.15
R0826:Myo16 UTSW 8 10376285 splice site probably benign
R0835:Myo16 UTSW 8 10272766 missense probably damaging 1.00
R1015:Myo16 UTSW 8 10390183 missense probably benign 0.17
R1052:Myo16 UTSW 8 10570181 missense possibly damaging 0.92
R1180:Myo16 UTSW 8 10396908 missense probably damaging 1.00
R1185:Myo16 UTSW 8 10633624 missense probably damaging 1.00
R1185:Myo16 UTSW 8 10633624 missense probably damaging 1.00
R1474:Myo16 UTSW 8 10502796 missense probably damaging 1.00
R1484:Myo16 UTSW 8 10560145 missense probably damaging 1.00
R1503:Myo16 UTSW 8 10502817 missense probably benign 0.44
R1733:Myo16 UTSW 8 10442283 missense probably damaging 0.98
R1873:Myo16 UTSW 8 10272789 missense probably damaging 1.00
R1885:Myo16 UTSW 8 10322656 missense probably damaging 1.00
R1943:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2013:Myo16 UTSW 8 10502796 missense probably damaging 1.00
R2019:Myo16 UTSW 8 10376260 missense probably benign 0.05
R2022:Myo16 UTSW 8 10272633 missense probably benign 0.08
R2214:Myo16 UTSW 8 10438803 missense probably damaging 1.00
R2228:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2351:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2352:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2357:Myo16 UTSW 8 10594905 missense possibly damaging 0.63
R2566:Myo16 UTSW 8 10594820 missense probably benign 0.43
R3402:Myo16 UTSW 8 10384719 missense probably benign
R3870:Myo16 UTSW 8 10442239 missense probably benign 0.25
R4080:Myo16 UTSW 8 10562240 missense probably damaging 1.00
R4498:Myo16 UTSW 8 10435869 missense probably benign 0.01
R4631:Myo16 UTSW 8 10506984 missense probably damaging 1.00
R4689:Myo16 UTSW 8 10438890 missense probably damaging 1.00
R4736:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4738:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4739:Myo16 UTSW 8 10373527 missense probably damaging 1.00
R4764:Myo16 UTSW 8 10435880 missense probably damaging 1.00
R4778:Myo16 UTSW 8 10569694 missense probably damaging 0.97
R4852:Myo16 UTSW 8 10373474 missense probably damaging 1.00
R4885:Myo16 UTSW 8 10438892 missense probably damaging 0.98
R4993:Myo16 UTSW 8 10476094 missense probably damaging 0.99
R5077:Myo16 UTSW 8 10322658 missense probably damaging 1.00
R5135:Myo16 UTSW 8 10476114 missense probably benign
R5170:Myo16 UTSW 8 10569745 missense probably benign 0.30
R5203:Myo16 UTSW 8 10360995 missense probably damaging 1.00
R5246:Myo16 UTSW 8 10562212 nonsense probably null
R5517:Myo16 UTSW 8 10560226 missense probably benign 0.22
R5567:Myo16 UTSW 8 10322676 missense probably damaging 1.00
R5694:Myo16 UTSW 8 10569606 missense probably benign 0.01
R5749:Myo16 UTSW 8 10413245 missense probably benign 0.01
R6131:Myo16 UTSW 8 10569877 missense probably benign
R6216:Myo16 UTSW 8 10315494 missense probably benign 0.01
R6240:Myo16 UTSW 8 10370930 missense probably damaging 1.00
R6628:Myo16 UTSW 8 10570638 missense probably damaging 0.99
R6935:Myo16 UTSW 8 10569820 missense probably benign 0.37
R6996:Myo16 UTSW 8 10569496 missense probably damaging 1.00
R7103:Myo16 UTSW 8 10569673 missense unknown
R7164:Myo16 UTSW 8 10569585 missense unknown
R7255:Myo16 UTSW 8 10499169 missense unknown
R7266:Myo16 UTSW 8 10272687 missense unknown
R7319:Myo16 UTSW 8 10476185 synonymous probably null
R7398:Myo16 UTSW 8 10562183 missense unknown
R7442:Myo16 UTSW 8 10272537 missense probably damaging 1.00
R7498:Myo16 UTSW 8 10400589 missense unknown
R7539:Myo16 UTSW 8 10361095 critical splice donor site probably null
X0066:Myo16 UTSW 8 10376185 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCGTGTTTCAGATCCAATGC -3'
(R):5'- TGCCCTTGGGAAAGTAAGTTTTC -3'

Sequencing Primer
(F):5'- GTTCAGCCTACACTATTGAACAG -3'
(R):5'- GATGACACCATTAGGAATCAA -3'
Posted On2018-02-27