Incidental Mutation 'R6213:F11'
ID503566
Institutional Source Beutler Lab
Gene Symbol F11
Ensembl Gene ENSMUSG00000031645
Gene Namecoagulation factor XI
SynonymsFXI, plasma thromboplastin antecedent, Cf11, 1600027G01Rik
MMRRC Submission 044346-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6213 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location45241174-45262031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 45241500 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 608 (T608K)
Ref Sequence ENSEMBL: ENSMUSP00000034064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034064]
Predicted Effect probably damaging
Transcript: ENSMUST00000034064
AA Change: T608K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034064
Gene: ENSMUSG00000031645
AA Change: T608K

DomainStartEndE-ValueType
APPLE 20 103 2.89e-29 SMART
APPLE 110 193 1.02e-29 SMART
APPLE 200 283 2.29e-32 SMART
APPLE 291 376 1.04e-30 SMART
Tryp_SPc 389 617 1.54e-98 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a glycoprotein coagulation factor that plays an important role in intrinsic pathway of blood coagulation and hemostasis. The encoded protein is an inactive zymogen that can be activated by coagulation factor XIIa, thrombin or factor XIa to generate active factor XIa protease. Mice lacking the encoded protein display a survival advantage during peritoneal sepsis and resist inflammation and bacterial accumulation upon infection with Listeria. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show a tendency for slightly prolonged tail transection bleeding times and are protected from vessel-occluding fibrin formation after transient ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A G 16: 20,400,012 Y207H probably damaging Het
Adcy7 G A 8: 88,314,137 V335M probably damaging Het
Apol11b A C 15: 77,638,000 D32E possibly damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdkn1b T A 6: 134,921,243 D108E probably benign Het
Cep290 A G 10: 100,523,360 D984G probably benign Het
Csde1 T C 3: 103,040,514 V128A probably damaging Het
Csmd3 A G 15: 47,629,260 S3162P probably damaging Het
D5Ertd579e G A 5: 36,602,634 T1394I probably damaging Het
Ddx6 T A 9: 44,628,693 L306Q probably damaging Het
Dmxl1 T A 18: 49,863,015 S403T possibly damaging Het
Flrt3 C T 2: 140,661,165 R181H probably damaging Het
Hs3st1 A T 5: 39,614,521 C260S probably damaging Het
Ighv7-1 A T 12: 113,896,521 S84T probably damaging Het
Inpp4b A G 8: 81,997,390 D332G probably damaging Het
Irf2bpl T C 12: 86,883,593 Q102R probably benign Het
Itpr3 T A 17: 27,111,200 D1597E probably benign Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Lypd8 A G 11: 58,390,334 T241A probably benign Het
Map1lc3a T C 2: 155,277,015 probably null Het
Mast1 G A 8: 84,915,569 T1052I probably damaging Het
Muc2 T C 7: 141,751,414 C152R probably damaging Het
Muc5b A T 7: 141,862,166 M2950L probably benign Het
Muc5b A G 7: 141,867,619 D4282G possibly damaging Het
Myo16 G T 8: 10,370,963 probably null Het
Myo9a T A 9: 59,827,258 F708I probably damaging Het
Nadsyn1 A T 7: 143,799,812 F558Y probably benign Het
Nat9 A T 11: 115,185,106 W30R probably damaging Het
Nipbl A G 15: 8,334,906 L1338S probably damaging Het
Nipsnap3b A G 4: 53,017,066 T97A probably benign Het
Npepps A T 11: 97,241,997 Y301* probably null Het
Nrcam C T 12: 44,562,432 P447S possibly damaging Het
Olfr237-ps1 A G 6: 43,153,887 N194S possibly damaging Het
Olfr295 A G 7: 86,585,277 M1V probably null Het
Olfr547 T C 7: 102,534,932 Y62H probably damaging Het
Olfr99 T C 17: 37,280,373 S16G probably benign Het
Pacsin3 G T 2: 91,260,434 V29F probably damaging Het
Pdzrn3 A C 6: 101,377,844 D15E probably damaging Het
Phf20l1 T C 15: 66,632,903 probably null Het
Pign A C 1: 105,589,266 V545G possibly damaging Het
Pkhd1 T C 1: 20,523,770 N1373S possibly damaging Het
Ptchd4 T A 17: 42,377,360 H264Q probably benign Het
Ptpn3 G T 4: 57,265,012 Q73K probably damaging Het
Ptrh1 G A 2: 32,776,745 V109I probably benign Het
Reg1 A T 6: 78,427,403 I87F possibly damaging Het
Rrp12 C A 19: 41,868,778 V1186L probably benign Het
Sall1 AGTGGTGGTGGTGGTGGTGGTGG AGTGGTGGTGGTGGTGGTGG 8: 89,033,058 probably benign Het
Slc23a3 A C 1: 75,131,748 F279V probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Suds3 A G 5: 117,106,662 L115P probably damaging Het
Tekt2 G A 4: 126,323,196 A260V probably damaging Het
Tgfb3 T A 12: 86,057,847 Y391F probably damaging Het
Topbp1 T C 9: 103,332,751 S866P probably benign Het
Tspan14 A G 14: 40,913,415 Y175H probably benign Het
Vars2 T C 17: 35,660,440 T568A probably benign Het
Vmn1r216 T G 13: 23,099,169 D7E probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zfp281 T C 1: 136,625,512 V76A probably benign Het
Zfp36l2 T C 17: 84,186,552 N219S probably damaging Het
Zfp626 T C 7: 27,808,292 M42T probably benign Het
Zscan21 C T 5: 138,125,097 P13S probably benign Het
Other mutations in F11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:F11 APN 8 45250095 missense probably damaging 1.00
IGL02096:F11 APN 8 45246754 missense probably benign 0.05
IGL02363:F11 APN 8 45241531 missense probably damaging 1.00
IGL02694:F11 APN 8 45252159 missense probably damaging 1.00
IGL03374:F11 APN 8 45261074 missense possibly damaging 0.63
R0225:F11 UTSW 8 45249077 missense probably benign 0.00
R0525:F11 UTSW 8 45253049 missense probably benign 0.01
R0842:F11 UTSW 8 45252159 missense probably damaging 1.00
R0961:F11 UTSW 8 45241494 missense probably damaging 1.00
R1605:F11 UTSW 8 45241580 missense probably damaging 1.00
R2044:F11 UTSW 8 45252118 missense probably benign 0.03
R2113:F11 UTSW 8 45246832 missense probably benign 0.00
R2273:F11 UTSW 8 45252147 missense possibly damaging 0.94
R2274:F11 UTSW 8 45252147 missense possibly damaging 0.94
R2275:F11 UTSW 8 45252147 missense possibly damaging 0.94
R2318:F11 UTSW 8 45248638 missense probably damaging 1.00
R2319:F11 UTSW 8 45248638 missense probably damaging 1.00
R2403:F11 UTSW 8 45248638 missense probably damaging 1.00
R2510:F11 UTSW 8 45248638 missense probably damaging 1.00
R2512:F11 UTSW 8 45261061 missense probably benign 0.01
R2893:F11 UTSW 8 45248638 missense probably damaging 1.00
R2894:F11 UTSW 8 45248638 missense probably damaging 1.00
R2910:F11 UTSW 8 45241449 makesense probably null
R3030:F11 UTSW 8 45248638 missense probably damaging 1.00
R3105:F11 UTSW 8 45245717 missense probably damaging 0.97
R3721:F11 UTSW 8 45248638 missense probably damaging 1.00
R3726:F11 UTSW 8 45248638 missense probably damaging 1.00
R3906:F11 UTSW 8 45248638 missense probably damaging 1.00
R3909:F11 UTSW 8 45248638 missense probably damaging 1.00
R4465:F11 UTSW 8 45241474 missense probably damaging 1.00
R4467:F11 UTSW 8 45241474 missense probably damaging 1.00
R4710:F11 UTSW 8 45250146 missense probably damaging 1.00
R4824:F11 UTSW 8 45255342 missense probably damaging 0.99
R4968:F11 UTSW 8 45245733 missense probably benign 0.19
R5225:F11 UTSW 8 45255304 missense probably benign 0.09
R5288:F11 UTSW 8 45246796 missense probably damaging 1.00
R5378:F11 UTSW 8 45252143 missense probably benign 0.19
R6155:F11 UTSW 8 45252082 missense probably damaging 1.00
R6615:F11 UTSW 8 45248774 missense probably benign
R6797:F11 UTSW 8 45253055 missense probably benign 0.02
R7147:F11 UTSW 8 45250146 missense probably damaging 1.00
R7683:F11 UTSW 8 45249508 missense probably damaging 0.97
R7688:F11 UTSW 8 45250090 missense probably damaging 1.00
R7720:F11 UTSW 8 45252090 missense possibly damaging 0.89
R8064:F11 UTSW 8 45245773 missense probably benign 0.01
U24488:F11 UTSW 8 45242312 missense probably benign 0.04
Z1088:F11 UTSW 8 45245772 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GGCCATTCAATTGGTTACAGTGG -3'
(R):5'- GCAAGCAGATCACTTGGTGG -3'

Sequencing Primer
(F):5'- GAAGAGTCAGTATCCCAGTGTCTTC -3'
(R):5'- CTTGTGAGAGGGCCAGAATATTATG -3'
Posted On2018-02-27