Incidental Mutation 'R6213:Inpp4b'
ID 503567
Institutional Source Beutler Lab
Gene Symbol Inpp4b
Ensembl Gene ENSMUSG00000037940
Gene Name inositol polyphosphate-4-phosphatase, type II
Synonyms E130107I17Rik
MMRRC Submission 044346-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.230) question?
Stock # R6213 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 82069185-82854543 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 82724019 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 332 (D332G)
Ref Sequence ENSEMBL: ENSMUSP00000132156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042529] [ENSMUST00000109851] [ENSMUST00000109852] [ENSMUST00000169116] [ENSMUST00000169387] [ENSMUST00000170160] [ENSMUST00000213285] [ENSMUST00000172031] [ENSMUST00000215332] [ENSMUST00000217122]
AlphaFold Q6P1Y8
Predicted Effect probably damaging
Transcript: ENSMUST00000042529
AA Change: D500G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044466
Gene: ENSMUSG00000037940
AA Change: D500G

DomainStartEndE-ValueType
C2 40 147 1.72e0 SMART
low complexity region 302 319 N/A INTRINSIC
low complexity region 425 434 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109851
AA Change: D385G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105477
Gene: ENSMUSG00000037940
AA Change: D385G

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
low complexity region 187 204 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
transmembrane domain 783 805 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109852
AA Change: D517G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105478
Gene: ENSMUSG00000037940
AA Change: D517G

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
transmembrane domain 915 937 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169116
AA Change: D517G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131947
Gene: ENSMUSG00000037940
AA Change: D517G

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169387
Predicted Effect probably damaging
Transcript: ENSMUST00000170160
AA Change: D332G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132156
Gene: ENSMUSG00000037940
AA Change: D332G

DomainStartEndE-ValueType
low complexity region 134 151 N/A INTRINSIC
low complexity region 257 266 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213285
AA Change: D517G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000172031
AA Change: D517G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131324
Gene: ENSMUSG00000037940
AA Change: D517G

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215332
AA Change: D517G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000217122
AA Change: D517G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.1137 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INPP4B encodes the inositol polyphosphate 4-phosphatase type II, one of the enzymes involved in phosphatidylinositol signaling pathways. This enzyme removes the phosphate group at position 4 of the inositol ring from inositol 3,4-bisphosphate. There is limited data to suggest that the human type II enzyme is subject to alternative splicing, as has been established for the type I enzyme. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit osteoporosis, reduced long bone length, increased osteoclast numbers and size, increased osteoblast numbers, and increased bone resorption and resorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A G 16: 20,218,762 (GRCm39) Y207H probably damaging Het
Adcy7 G A 8: 89,040,765 (GRCm39) V335M probably damaging Het
Apol11b A C 15: 77,522,200 (GRCm39) D32E possibly damaging Het
Ccdc13 A G 9: 121,627,975 (GRCm39) probably benign Het
Cdkn1b T A 6: 134,898,206 (GRCm39) D108E probably benign Het
Cep290 A G 10: 100,359,222 (GRCm39) D984G probably benign Het
Csde1 T C 3: 102,947,830 (GRCm39) V128A probably damaging Het
Csmd3 A G 15: 47,492,656 (GRCm39) S3162P probably damaging Het
D5Ertd579e G A 5: 36,759,978 (GRCm39) T1394I probably damaging Het
Ddx6 T A 9: 44,539,990 (GRCm39) L306Q probably damaging Het
Dmxl1 T A 18: 49,996,082 (GRCm39) S403T possibly damaging Het
F11 G T 8: 45,694,537 (GRCm39) T608K probably damaging Het
Flrt3 C T 2: 140,503,085 (GRCm39) R181H probably damaging Het
Hs3st1 A T 5: 39,771,864 (GRCm39) C260S probably damaging Het
Ighv7-1 A T 12: 113,860,141 (GRCm39) S84T probably damaging Het
Irf2bpl T C 12: 86,930,367 (GRCm39) Q102R probably benign Het
Itpr3 T A 17: 27,330,174 (GRCm39) D1597E probably benign Het
Kcnd1 G C X: 7,690,148 (GRCm39) A23P probably damaging Homo
Lypd8 A G 11: 58,281,160 (GRCm39) T241A probably benign Het
Map1lc3a T C 2: 155,118,935 (GRCm39) probably null Het
Mast1 G A 8: 85,642,198 (GRCm39) T1052I probably damaging Het
Muc2 T C 7: 141,305,151 (GRCm39) C152R probably damaging Het
Muc5b A T 7: 141,415,903 (GRCm39) M2950L probably benign Het
Muc5b A G 7: 141,421,356 (GRCm39) D4282G possibly damaging Het
Myo16 G T 8: 10,420,963 (GRCm39) probably null Het
Myo9a T A 9: 59,734,541 (GRCm39) F708I probably damaging Het
Nadsyn1 A T 7: 143,353,549 (GRCm39) F558Y probably benign Het
Nat9 A T 11: 115,075,932 (GRCm39) W30R probably damaging Het
Nipbl A G 15: 8,364,390 (GRCm39) L1338S probably damaging Het
Nipsnap3b A G 4: 53,017,066 (GRCm39) T97A probably benign Het
Npepps A T 11: 97,132,823 (GRCm39) Y301* probably null Het
Nrcam C T 12: 44,609,215 (GRCm39) P447S possibly damaging Het
Or14c41 A G 7: 86,234,485 (GRCm39) M1V probably null Het
Or1o4 T C 17: 37,591,264 (GRCm39) S16G probably benign Het
Or2a14 A G 6: 43,130,821 (GRCm39) N194S possibly damaging Het
Or52b4 T C 7: 102,184,139 (GRCm39) Y62H probably damaging Het
Pacsin3 G T 2: 91,090,779 (GRCm39) V29F probably damaging Het
Pdzrn3 A C 6: 101,354,805 (GRCm39) D15E probably damaging Het
Phf20l1 T C 15: 66,504,752 (GRCm39) probably null Het
Pign A C 1: 105,516,991 (GRCm39) V545G possibly damaging Het
Pkhd1 T C 1: 20,593,994 (GRCm39) N1373S possibly damaging Het
Ptchd4 T A 17: 42,688,251 (GRCm39) H264Q probably benign Het
Ptpn3 G T 4: 57,265,012 (GRCm39) Q73K probably damaging Het
Ptrh1 G A 2: 32,666,757 (GRCm39) V109I probably benign Het
Reg1 A T 6: 78,404,386 (GRCm39) I87F possibly damaging Het
Rrp12 C A 19: 41,857,217 (GRCm39) V1186L probably benign Het
Sall1 AGTGGTGGTGGTGGTGGTGGTGG AGTGGTGGTGGTGGTGGTGG 8: 89,759,686 (GRCm39) probably benign Het
Slc23a3 A C 1: 75,108,392 (GRCm39) F279V probably benign Het
Smtnl2 G A 11: 72,292,225 (GRCm39) A274V probably damaging Het
Suds3 A G 5: 117,244,727 (GRCm39) L115P probably damaging Het
Tekt2 G A 4: 126,216,989 (GRCm39) A260V probably damaging Het
Tgfb3 T A 12: 86,104,621 (GRCm39) Y391F probably damaging Het
Topbp1 T C 9: 103,209,950 (GRCm39) S866P probably benign Het
Tspan14 A G 14: 40,635,372 (GRCm39) Y175H probably benign Het
Vars2 T C 17: 35,971,332 (GRCm39) T568A probably benign Het
Vmn1r216 T G 13: 23,283,339 (GRCm39) D7E probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,578,962 (GRCm39) probably benign Het
Zfp281 T C 1: 136,553,250 (GRCm39) V76A probably benign Het
Zfp36l2 T C 17: 84,493,980 (GRCm39) N219S probably damaging Het
Zfp626 T C 7: 27,507,717 (GRCm39) M42T probably benign Het
Zscan21 C T 5: 138,123,359 (GRCm39) P13S probably benign Het
Other mutations in Inpp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Inpp4b APN 8 82,583,379 (GRCm39) missense probably damaging 1.00
IGL01481:Inpp4b APN 8 82,724,009 (GRCm39) missense probably damaging 1.00
IGL01509:Inpp4b APN 8 82,617,332 (GRCm39) splice site probably benign
IGL01515:Inpp4b APN 8 82,679,340 (GRCm39) missense possibly damaging 0.68
IGL01607:Inpp4b APN 8 82,737,292 (GRCm39) missense probably benign 0.03
IGL01643:Inpp4b APN 8 82,798,400 (GRCm39) missense probably damaging 0.97
IGL01736:Inpp4b APN 8 82,723,968 (GRCm39) missense probably benign 0.00
IGL02154:Inpp4b APN 8 82,696,130 (GRCm39) splice site probably benign
IGL02327:Inpp4b APN 8 82,768,591 (GRCm39) missense probably benign 0.01
IGL02413:Inpp4b APN 8 82,759,800 (GRCm39) missense probably benign
IGL02652:Inpp4b APN 8 82,497,429 (GRCm39) splice site probably benign
IGL02678:Inpp4b APN 8 82,583,373 (GRCm39) missense probably damaging 1.00
IGL03146:Inpp4b APN 8 82,470,410 (GRCm39) missense possibly damaging 0.61
LCD18:Inpp4b UTSW 8 82,419,639 (GRCm39) intron probably benign
PIT4280001:Inpp4b UTSW 8 82,761,046 (GRCm39) missense probably benign 0.00
PIT4480001:Inpp4b UTSW 8 82,772,896 (GRCm39) missense probably damaging 1.00
PIT4504001:Inpp4b UTSW 8 82,768,564 (GRCm39) missense probably damaging 1.00
R0083:Inpp4b UTSW 8 82,468,091 (GRCm39) missense possibly damaging 0.77
R0212:Inpp4b UTSW 8 82,497,546 (GRCm39) missense probably benign 0.00
R0285:Inpp4b UTSW 8 82,761,145 (GRCm39) splice site probably benign
R0363:Inpp4b UTSW 8 82,610,886 (GRCm39) splice site probably benign
R0364:Inpp4b UTSW 8 82,723,943 (GRCm39) missense probably benign 0.09
R0471:Inpp4b UTSW 8 82,768,528 (GRCm39) missense possibly damaging 0.94
R0550:Inpp4b UTSW 8 82,723,966 (GRCm39) missense probably benign 0.00
R0562:Inpp4b UTSW 8 82,494,780 (GRCm39) missense possibly damaging 0.88
R0661:Inpp4b UTSW 8 82,468,091 (GRCm39) missense possibly damaging 0.77
R0693:Inpp4b UTSW 8 82,723,943 (GRCm39) missense probably benign 0.09
R1081:Inpp4b UTSW 8 82,795,653 (GRCm39) missense probably damaging 0.97
R1251:Inpp4b UTSW 8 82,617,382 (GRCm39) missense probably benign 0.01
R1374:Inpp4b UTSW 8 82,470,445 (GRCm39) critical splice donor site probably null
R1445:Inpp4b UTSW 8 82,679,463 (GRCm39) splice site probably null
R1465:Inpp4b UTSW 8 82,494,786 (GRCm39) missense probably damaging 1.00
R1465:Inpp4b UTSW 8 82,494,786 (GRCm39) missense probably damaging 1.00
R1647:Inpp4b UTSW 8 82,583,403 (GRCm39) splice site probably benign
R1754:Inpp4b UTSW 8 82,497,440 (GRCm39) missense probably damaging 1.00
R1759:Inpp4b UTSW 8 82,494,732 (GRCm39) missense probably benign 0.06
R2085:Inpp4b UTSW 8 82,678,903 (GRCm39) missense probably damaging 1.00
R2156:Inpp4b UTSW 8 82,775,118 (GRCm39) missense probably damaging 1.00
R2160:Inpp4b UTSW 8 82,848,004 (GRCm39) nonsense probably null
R2175:Inpp4b UTSW 8 82,583,328 (GRCm39) missense probably damaging 1.00
R2191:Inpp4b UTSW 8 82,723,931 (GRCm39) missense probably damaging 1.00
R2401:Inpp4b UTSW 8 82,723,968 (GRCm39) missense probably benign 0.00
R2475:Inpp4b UTSW 8 82,768,607 (GRCm39) missense probably benign 0.09
R2512:Inpp4b UTSW 8 82,737,179 (GRCm39) missense probably damaging 1.00
R2919:Inpp4b UTSW 8 82,711,958 (GRCm39) missense possibly damaging 0.93
R3021:Inpp4b UTSW 8 82,629,467 (GRCm39) missense possibly damaging 0.47
R3423:Inpp4b UTSW 8 82,678,890 (GRCm39) missense possibly damaging 0.63
R3777:Inpp4b UTSW 8 82,768,621 (GRCm39) missense possibly damaging 0.89
R3778:Inpp4b UTSW 8 82,768,621 (GRCm39) missense possibly damaging 0.89
R3794:Inpp4b UTSW 8 82,759,845 (GRCm39) missense probably damaging 1.00
R3795:Inpp4b UTSW 8 82,759,845 (GRCm39) missense probably damaging 1.00
R4590:Inpp4b UTSW 8 82,468,040 (GRCm39) start codon destroyed probably null 1.00
R4602:Inpp4b UTSW 8 82,696,164 (GRCm39) missense probably damaging 0.99
R4691:Inpp4b UTSW 8 82,849,282 (GRCm39) missense probably damaging 1.00
R4924:Inpp4b UTSW 8 82,849,253 (GRCm39) missense probably damaging 1.00
R4992:Inpp4b UTSW 8 82,759,837 (GRCm39) missense probably damaging 1.00
R5219:Inpp4b UTSW 8 82,610,785 (GRCm39) missense probably benign 0.01
R5228:Inpp4b UTSW 8 82,494,744 (GRCm39) missense probably damaging 0.99
R5557:Inpp4b UTSW 8 82,678,888 (GRCm39) missense probably damaging 0.99
R5627:Inpp4b UTSW 8 82,470,445 (GRCm39) critical splice donor site probably benign
R5691:Inpp4b UTSW 8 82,617,323 (GRCm39) intron probably benign
R6186:Inpp4b UTSW 8 82,772,863 (GRCm39) missense probably damaging 0.99
R6232:Inpp4b UTSW 8 82,678,813 (GRCm39) missense probably damaging 1.00
R6283:Inpp4b UTSW 8 82,497,462 (GRCm39) missense probably damaging 1.00
R6302:Inpp4b UTSW 8 82,494,806 (GRCm39) missense probably benign 0.00
R6309:Inpp4b UTSW 8 82,768,546 (GRCm39) missense probably damaging 1.00
R6360:Inpp4b UTSW 8 82,629,481 (GRCm39) missense probably benign 0.20
R6477:Inpp4b UTSW 8 82,571,343 (GRCm39) splice site probably null
R6773:Inpp4b UTSW 8 82,583,249 (GRCm39) intron probably benign
R6968:Inpp4b UTSW 8 82,571,086 (GRCm39) missense probably benign 0.18
R7147:Inpp4b UTSW 8 82,629,400 (GRCm39) missense probably damaging 1.00
R7318:Inpp4b UTSW 8 82,798,374 (GRCm39) missense probably damaging 1.00
R7409:Inpp4b UTSW 8 82,679,314 (GRCm39) splice site probably null
R7455:Inpp4b UTSW 8 82,798,332 (GRCm39) missense probably damaging 0.99
R7632:Inpp4b UTSW 8 82,772,968 (GRCm39) missense probably damaging 1.00
R7844:Inpp4b UTSW 8 82,467,949 (GRCm39) start gained probably benign
R7958:Inpp4b UTSW 8 82,696,218 (GRCm39) missense probably damaging 1.00
R8440:Inpp4b UTSW 8 82,768,524 (GRCm39) missense probably damaging 1.00
R9160:Inpp4b UTSW 8 82,610,782 (GRCm39) missense possibly damaging 0.55
R9303:Inpp4b UTSW 8 82,759,758 (GRCm39) missense probably damaging 1.00
R9390:Inpp4b UTSW 8 82,497,522 (GRCm39) missense probably damaging 1.00
R9583:Inpp4b UTSW 8 82,497,555 (GRCm39) critical splice donor site probably null
R9705:Inpp4b UTSW 8 82,772,890 (GRCm39) missense probably benign 0.14
R9778:Inpp4b UTSW 8 82,775,160 (GRCm39) missense probably benign
RF003:Inpp4b UTSW 8 82,696,150 (GRCm39) nonsense probably null
Z1088:Inpp4b UTSW 8 82,795,560 (GRCm39) critical splice acceptor site probably null
Z1176:Inpp4b UTSW 8 82,795,630 (GRCm39) missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- TCCATGCCTTCAAGGACCAG -3'
(R):5'- GATGCATAGGATGATCAGGTTTTC -3'

Sequencing Primer
(F):5'- AGCTGGTCAGGAGTGCTC -3'
(R):5'- GCATAGGATGATCAGGTTTTCTTTTG -3'
Posted On 2018-02-27