Mutagenetix > Incidental Mutation

Incidental Mutation 'R6214:Prom2'

503604

Institutional Source

Beutler Lab

Gene Symbol

Prom2

Ensembl Gene

ENSMUSG00000027376

Gene Name

prominin 2

Synonyms

MMRRC Submission

044347-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6214 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

127526473-127541467 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 127539775 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000099503 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028855] [ENSMUST00000103214]

AlphaFold

Q3UUY6

Predicted Effect

probably null
Transcript: ENSMUST00000028855

SMART Domains

Protein: ENSMUSP00000028855
Gene: ENSMUSG00000027376

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Prominin	25	808	3.6e-279	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000103214

SMART Domains

Protein: ENSMUSP00000099503
Gene: ENSMUSG00000027376

Domain	Start	End	E-Value	Type
Pfam:Prominin	18	818	3e-288	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140156

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155581

Meta Mutation Damage Score

0.9480

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prominin family of pentaspan membrane glycoproteins. The encoded protein localizes to basal epithelial cells and may be involved in the organization of plasma membrane microdomains. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutant mice exhibited signs of anemia, with decreased mean red blood cell count and decreased mean hemoglobin and hematocrit levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asap3	A	C	4: 136,241,425	D727A	possibly damaging	Het
Aste1	A	G	9: 105,396,857	K38E	probably damaging	Het
Atp13a5	T	C	16: 29,251,407	Y909C	probably damaging	Het
Ccdc13	A	G	9: 121,798,909		probably benign	Het
Cd79b	C	A	11: 106,312,441		probably null	Het
Chia1	T	C	3: 106,122,445	F132L	probably damaging	Het
Cntrl	A	G	2: 35,129,634	E491G	probably benign	Het
Ctdnep1	T	C	11: 69,989,508	F206L	probably damaging	Het
Dido1	T	C	2: 180,662,152	K1320E	probably damaging	Het
Dmbt1	G	T	7: 131,066,733	C573F	possibly damaging	Het
Dmtn	A	G	14: 70,613,336	I205T	probably benign	Het
Eif4g3	C	T	4: 138,058,003	H137Y	probably damaging	Het
Flg2	G	T	3: 93,201,859	C398F	possibly damaging	Het
Gabbr1	A	G	17: 37,069,365	D604G	probably damaging	Het
Glis2	T	A	16: 4,610,333	L83*	probably null	Het
Glra3	A	G	8: 55,991,256		probably null	Het
Gm15448	A	G	7: 3,821,718	I554T	probably damaging	Het
Gm8890	C	T	5: 11,257,230	T25I	probably damaging	Het
Hipk3	T	C	2: 104,433,741	D804G	probably damaging	Het
Kcnd1	G	C	X: 7,823,909	A23P	probably damaging	Homo
Lrrc9	A	T	12: 72,459,853	E301D	probably damaging	Het
Ms4a6c	T	C	19: 11,471,136	I11T	possibly damaging	Het
Myo1d	A	T	11: 80,779,791	M1K	probably null	Het
Nav3	A	G	10: 109,852,565	L617P	probably damaging	Het
Olfr918	A	G	9: 38,673,214	S90P	probably benign	Het
Pcsk7	A	C	9: 45,910,376	N156T	possibly damaging	Het
Pde4d	C	T	13: 109,949,433	S515L	probably damaging	Het
Rsf1	G	GACGGCGGCA	7: 97,579,909		probably benign	Het
Scn3a	T	C	2: 65,495,036	I1046V	probably benign	Het
Slc13a1	A	T	6: 24,090,796	Y541*	probably null	Het
Spen	C	T	4: 141,479,112	E735K	unknown	Het
Tm6sf2	T	C	8: 70,073,074	V27A	possibly damaging	Het
Trim21	A	G	7: 102,559,439	S358P	probably damaging	Het
Ttc21a	A	G	9: 119,966,772	Y1224C	probably damaging	Het
Ttn	T	A	2: 76,880,208		probably benign	Het
Vmn2r99	A	G	17: 19,382,558	Q525R	probably benign	Het
Vsig10	G	A	5: 117,343,924	C393Y	probably damaging	Het
Ywhag	A	G	5: 135,911,074	I222T	probably damaging	Het

Other mutations in Prom2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Prom2	APN	2	127541139	missense	probably benign	0.04
IGL01140:Prom2	APN	2	127531205	splice site	probably benign
IGL01300:Prom2	APN	2	127535089	missense	probably benign	0.44
IGL01445:Prom2	APN	2	127539513	splice site	probably benign
IGL01472:Prom2	APN	2	127532882	missense	probably benign	0.39
IGL01541:Prom2	APN	2	127529130	critical splice donor site	probably null
IGL01991:Prom2	APN	2	127529222	missense	probably damaging	1.00
IGL02421:Prom2	APN	2	127531882	critical splice acceptor site	probably null
IGL02557:Prom2	APN	2	127529471	missense	possibly damaging	0.85
IGL02724:Prom2	APN	2	127538657	splice site	probably benign
IGL02826:Prom2	APN	2	127531116	missense	probably benign	0.07
IGL02830:Prom2	APN	2	127535069	missense	possibly damaging	0.88
IGL02990:Prom2	APN	2	127528814	missense	probably benign	0.10
R0110:Prom2	UTSW	2	127531113	missense	possibly damaging	0.53
R0133:Prom2	UTSW	2	127538338	splice site	probably benign
R0165:Prom2	UTSW	2	127539514	splice site	probably benign
R0220:Prom2	UTSW	2	127541107	missense	probably benign	0.03
R0466:Prom2	UTSW	2	127528789	missense	probably damaging	0.99
R0505:Prom2	UTSW	2	127532867	missense	possibly damaging	0.82
R0605:Prom2	UTSW	2	127539995	critical splice donor site	probably null
R0633:Prom2	UTSW	2	127539525	missense	probably benign	0.19
R0947:Prom2	UTSW	2	127538263	missense	possibly damaging	0.69
R1682:Prom2	UTSW	2	127540162	missense	possibly damaging	0.90
R1806:Prom2	UTSW	2	127532882	missense	probably damaging	1.00
R1859:Prom2	UTSW	2	127541097	missense	probably damaging	0.97
R1864:Prom2	UTSW	2	127539787	missense	probably benign	0.00
R1866:Prom2	UTSW	2	127536594	missense	probably damaging	0.99
R3824:Prom2	UTSW	2	127535673	splice site	probably benign
R4472:Prom2	UTSW	2	127540191	missense	probably benign	0.06
R5078:Prom2	UTSW	2	127531837	missense	probably benign	0.00
R5889:Prom2	UTSW	2	127529411	missense	possibly damaging	0.79
R5930:Prom2	UTSW	2	127530133	nonsense	probably null
R6215:Prom2	UTSW	2	127539775	critical splice donor site	probably null
R6914:Prom2	UTSW	2	127530375	missense	possibly damaging	0.78
R7099:Prom2	UTSW	2	127539778	missense	probably benign
R7427:Prom2	UTSW	2	127539811	missense	probably damaging	0.99
R7428:Prom2	UTSW	2	127539811	missense	probably damaging	0.99
R7525:Prom2	UTSW	2	127532781	missense	probably benign
R8477:Prom2	UTSW	2	127539204	missense	probably benign	0.01
R9287:Prom2	UTSW	2	127538265	missense	probably damaging	0.98
R9337:Prom2	UTSW	2	127529174	missense	probably damaging	0.99
Z1176:Prom2	UTSW	2	127532775	missense	probably damaging	1.00
Z1177:Prom2	UTSW	2	127538305	missense	probably damaging	1.00
Z1177:Prom2	UTSW	2	127539526	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- TCCTAAGCAAACACAGGGGC -3'
(R):5'- TTCTGTGAGAGGCTCCCTAG -3'

Sequencing Primer
(F):5'- CCTAAGCAAACACAGGGGCATTAG -3'
(R):5'- TGTGAGAGGCTCCCTAGGTCAG -3'

Posted On

2018-02-27