Incidental Mutation 'R6214:Dido1'
ID 503605
Institutional Source Beutler Lab
Gene Symbol Dido1
Ensembl Gene ENSMUSG00000038914
Gene Name death inducer-obliterator 1
Synonyms 6720461J16Rik, DIO-1, Datf1, D130048F08Rik
MMRRC Submission 044347-MU
Accession Numbers

Genbank: NM_175551; MGI: 1344352
Essential gene? Probably essential (E-score: 0.963) question?
Stock # R6214 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 180657964-180709999 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 180662152 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1320 (K1320E)
Ref Sequence ENSEMBL: ENSMUSP00000084794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087517]
AlphaFold Q8C9B9
Predicted Effect probably damaging
Transcript: ENSMUST00000087517
AA Change: K1320E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084794
Gene: ENSMUSG00000038914
AA Change: K1320E

DomainStartEndE-ValueType
low complexity region 134 155 N/A INTRINSIC
PHD 267 317 1.19e-11 SMART
low complexity region 430 446 N/A INTRINSIC
TFS2M 669 770 1.16e-45 SMART
low complexity region 937 962 N/A INTRINSIC
low complexity region 1023 1037 N/A INTRINSIC
Pfam:SPOC 1052 1158 1e-22 PFAM
low complexity region 1253 1267 N/A INTRINSIC
low complexity region 1279 1308 N/A INTRINSIC
low complexity region 1372 1391 N/A INTRINSIC
coiled coil region 1458 1502 N/A INTRINSIC
low complexity region 1649 1680 N/A INTRINSIC
low complexity region 1748 1766 N/A INTRINSIC
low complexity region 1780 1792 N/A INTRINSIC
low complexity region 1804 1815 N/A INTRINSIC
internal_repeat_2 1816 1852 3.9e-5 PROSPERO
internal_repeat_1 1819 1859 6.92e-7 PROSPERO
internal_repeat_2 1926 1964 3.9e-5 PROSPERO
internal_repeat_1 1940 1982 6.92e-7 PROSPERO
low complexity region 2025 2045 N/A INTRINSIC
low complexity region 2123 2160 N/A INTRINSIC
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2182 2239 N/A INTRINSIC
Meta Mutation Damage Score 0.2021 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: This gene encodes a transcription factor involved in apoptosis. The encoded protein functions in cell cycle progression and plays a role in chromosomal stability. This protein regulates the self-renewal of embryonic stem cells. Disruption of this gene in mice causes symptoms similar to myelodysplastic/myeloproliferative diseases in humans. Mice lacking this gene show severely reduced fertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severely reduced fertility; about one-half develop a transplantable disease characterized by anomalies in spleen, bone marrow, and peripheral blood and including anemia and various symptoms typical of myeloid dysplasia or myeloid proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(245) : Targeted, knock-out(1) Gene trapped(244)
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap3 A C 4: 136,241,425 D727A possibly damaging Het
Aste1 A G 9: 105,396,857 K38E probably damaging Het
Atp13a5 T C 16: 29,251,407 Y909C probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cd79b C A 11: 106,312,441 probably null Het
Chia1 T C 3: 106,122,445 F132L probably damaging Het
Cntrl A G 2: 35,129,634 E491G probably benign Het
Ctdnep1 T C 11: 69,989,508 F206L probably damaging Het
Dmbt1 G T 7: 131,066,733 C573F possibly damaging Het
Dmtn A G 14: 70,613,336 I205T probably benign Het
Eif4g3 C T 4: 138,058,003 H137Y probably damaging Het
Flg2 G T 3: 93,201,859 C398F possibly damaging Het
Gabbr1 A G 17: 37,069,365 D604G probably damaging Het
Glis2 T A 16: 4,610,333 L83* probably null Het
Glra3 A G 8: 55,991,256 probably null Het
Gm15448 A G 7: 3,821,718 I554T probably damaging Het
Gm8890 C T 5: 11,257,230 T25I probably damaging Het
Hipk3 T C 2: 104,433,741 D804G probably damaging Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Lrrc9 A T 12: 72,459,853 E301D probably damaging Het
Ms4a6c T C 19: 11,471,136 I11T possibly damaging Het
Myo1d A T 11: 80,779,791 M1K probably null Het
Nav3 A G 10: 109,852,565 L617P probably damaging Het
Olfr918 A G 9: 38,673,214 S90P probably benign Het
Pcsk7 A C 9: 45,910,376 N156T possibly damaging Het
Pde4d C T 13: 109,949,433 S515L probably damaging Het
Prom2 A G 2: 127,539,775 probably null Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Scn3a T C 2: 65,495,036 I1046V probably benign Het
Slc13a1 A T 6: 24,090,796 Y541* probably null Het
Spen C T 4: 141,479,112 E735K unknown Het
Tm6sf2 T C 8: 70,073,074 V27A possibly damaging Het
Trim21 A G 7: 102,559,439 S358P probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Ttn T A 2: 76,880,208 probably benign Het
Vmn2r99 A G 17: 19,382,558 Q525R probably benign Het
Vsig10 G A 5: 117,343,924 C393Y probably damaging Het
Ywhag A G 5: 135,911,074 I222T probably damaging Het
Other mutations in Dido1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Dido1 APN 2 180683989 missense probably benign
IGL00834:Dido1 APN 2 180689526 missense possibly damaging 0.87
IGL01317:Dido1 APN 2 180671757 missense probably benign 0.17
IGL01588:Dido1 APN 2 180688875 missense probably benign 0.00
IGL01834:Dido1 APN 2 180684031 splice site probably benign
IGL02102:Dido1 APN 2 180662247 missense possibly damaging 0.58
IGL02556:Dido1 APN 2 180689335 missense possibly damaging 0.69
IGL02756:Dido1 APN 2 180661923 missense probably benign 0.00
IGL02826:Dido1 APN 2 180683958 missense probably benign
IGL02970:Dido1 APN 2 180689415 missense probably damaging 0.99
IGL03110:Dido1 APN 2 180689342 missense probably damaging 1.00
IGL03116:Dido1 APN 2 180670979 missense probably damaging 1.00
3370:Dido1 UTSW 2 180671542 missense probably benign
A4554:Dido1 UTSW 2 180675371 missense probably damaging 1.00
H8441:Dido1 UTSW 2 180689014 missense probably benign 0.12
R0044:Dido1 UTSW 2 180661819 missense probably damaging 1.00
R0044:Dido1 UTSW 2 180661819 missense probably damaging 1.00
R0054:Dido1 UTSW 2 180661474 missense probably benign 0.00
R0054:Dido1 UTSW 2 180661474 missense probably benign 0.00
R0127:Dido1 UTSW 2 180671824 missense probably benign 0.01
R0620:Dido1 UTSW 2 180659851 missense probably benign 0.26
R0734:Dido1 UTSW 2 180660042 missense probably benign 0.01
R1390:Dido1 UTSW 2 180685124 missense possibly damaging 0.70
R1445:Dido1 UTSW 2 180671470 missense possibly damaging 0.62
R1466:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R1466:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R1472:Dido1 UTSW 2 180660720 missense probably benign 0.02
R1538:Dido1 UTSW 2 180684970 missense possibly damaging 0.49
R1584:Dido1 UTSW 2 180662328 missense probably damaging 1.00
R2020:Dido1 UTSW 2 180659585 missense unknown
R2025:Dido1 UTSW 2 180689181 nonsense probably null
R2026:Dido1 UTSW 2 180689181 nonsense probably null
R2027:Dido1 UTSW 2 180689181 nonsense probably null
R2089:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2091:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2091:Dido1 UTSW 2 180661884 missense probably benign 0.29
R2495:Dido1 UTSW 2 180689388 missense probably benign 0.00
R2931:Dido1 UTSW 2 180661653 missense probably damaging 1.00
R3418:Dido1 UTSW 2 180660935 missense possibly damaging 0.84
R3735:Dido1 UTSW 2 180684036 splice site probably benign
R4523:Dido1 UTSW 2 180672292 missense probably damaging 1.00
R4674:Dido1 UTSW 2 180687559 missense probably damaging 0.97
R4729:Dido1 UTSW 2 180687650 missense probably benign 0.00
R4762:Dido1 UTSW 2 180689575 missense probably damaging 1.00
R4786:Dido1 UTSW 2 180670871 missense possibly damaging 0.85
R4817:Dido1 UTSW 2 180661416 missense probably benign 0.02
R4892:Dido1 UTSW 2 180675029 nonsense probably null
R4979:Dido1 UTSW 2 180660813 missense probably damaging 0.98
R5510:Dido1 UTSW 2 180685173 missense probably benign 0.00
R5586:Dido1 UTSW 2 180659652 nonsense probably null
R5672:Dido1 UTSW 2 180671903 missense probably damaging 0.99
R5863:Dido1 UTSW 2 180661773 missense probably benign 0.02
R5943:Dido1 UTSW 2 180661882 missense probably benign 0.00
R5974:Dido1 UTSW 2 180671497 missense probably benign 0.02
R6123:Dido1 UTSW 2 180683967 missense probably benign 0.07
R6215:Dido1 UTSW 2 180662152 missense probably damaging 1.00
R6248:Dido1 UTSW 2 180660255 missense probably damaging 1.00
R6285:Dido1 UTSW 2 180661147 missense probably benign 0.00
R6349:Dido1 UTSW 2 180660701 missense probably benign 0.03
R6437:Dido1 UTSW 2 180675013 missense probably damaging 1.00
R6477:Dido1 UTSW 2 180660481 missense probably benign 0.00
R6836:Dido1 UTSW 2 180662307 missense probably benign 0.16
R7055:Dido1 UTSW 2 180661209 missense probably benign 0.09
R7289:Dido1 UTSW 2 180659631 missense unknown
R7304:Dido1 UTSW 2 180687493 missense probably damaging 1.00
R7343:Dido1 UTSW 2 180675121 missense possibly damaging 0.49
R7363:Dido1 UTSW 2 180662517 nonsense probably null
R7429:Dido1 UTSW 2 180689526 missense possibly damaging 0.87
R7594:Dido1 UTSW 2 180675112 missense probably benign
R7629:Dido1 UTSW 2 180661473 missense probably benign
R7899:Dido1 UTSW 2 180671597 missense possibly damaging 0.82
R7946:Dido1 UTSW 2 180661708 missense possibly damaging 0.81
R7951:Dido1 UTSW 2 180670881 missense probably benign 0.01
R8033:Dido1 UTSW 2 180674842 missense probably damaging 1.00
R8069:Dido1 UTSW 2 180660912 missense probably benign
R8331:Dido1 UTSW 2 180660449 missense probably benign 0.00
R8479:Dido1 UTSW 2 180673229 critical splice donor site probably null
R8936:Dido1 UTSW 2 180661402 missense probably benign
R9089:Dido1 UTSW 2 180661500 missense probably benign 0.00
R9647:Dido1 UTSW 2 180673275 missense probably benign 0.00
R9648:Dido1 UTSW 2 180660675 missense probably damaging 1.00
R9784:Dido1 UTSW 2 180683561 missense probably benign 0.27
V1024:Dido1 UTSW 2 180689014 missense probably benign 0.12
X0011:Dido1 UTSW 2 180660834 missense probably benign 0.00
X0019:Dido1 UTSW 2 180671572 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TCGTAGGGCCTGTCATCTTC -3'
(R):5'- ACAGTGTACACTCTATAGACACAGC -3'

Sequencing Primer
(F):5'- TAGGGCCTGTCATCTTCCTCCTC -3'
(R):5'- TCTATAGACACAGCTGCTACCAG -3'
Posted On 2018-02-27