Incidental Mutation 'R6214:Vsig10'
ID503612
Institutional Source Beutler Lab
Gene Symbol Vsig10
Ensembl Gene ENSMUSG00000066894
Gene NameV-set and immunoglobulin domain containing 10
Synonyms
MMRRC Submission 044347-MU
Accession Numbers

Genbank: NM_001033311; MGI: 2448533

Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6214 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location117319083-117355005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 117343924 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 393 (C393Y)
Ref Sequence ENSEMBL: ENSMUSP00000107598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086464] [ENSMUST00000111967]
Predicted Effect probably damaging
Transcript: ENSMUST00000086464
AA Change: C366Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083655
Gene: ENSMUSG00000066894
AA Change: C366Y

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
IG 23 114 4.03e-8 SMART
IG 132 214 9.49e-5 SMART
Pfam:Ig_2 215 300 2.6e-2 PFAM
Pfam:Ig_3 216 284 3.5e-4 PFAM
IGc2 313 384 1.12e-6 SMART
transmembrane domain 403 425 N/A INTRINSIC
coiled coil region 446 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111967
AA Change: C393Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107598
Gene: ENSMUSG00000066894
AA Change: C393Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 50 141 4.03e-8 SMART
IG 159 241 9.49e-5 SMART
Blast:IG_like 248 327 2e-33 BLAST
IGc2 340 411 1.12e-6 SMART
transmembrane domain 430 452 N/A INTRINSIC
coiled coil region 473 508 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147182
SMART Domains Protein: ENSMUSP00000125808
Gene: ENSMUSG00000066894

DomainStartEndE-ValueType
Blast:IG_like 1 41 3e-14 BLAST
IGc2 54 125 1.12e-6 SMART
transmembrane domain 144 166 N/A INTRINSIC
coiled coil region 187 222 N/A INTRINSIC
Meta Mutation Damage Score 0.3217 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 97% (37/38)
Allele List at MGI

All alleles(11) : Gene trapped(11)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap3 A C 4: 136,241,425 D727A possibly damaging Het
Aste1 A G 9: 105,396,857 K38E probably damaging Het
Atp13a5 T C 16: 29,251,407 Y909C probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cd79b C A 11: 106,312,441 probably null Het
Chia1 T C 3: 106,122,445 F132L probably damaging Het
Cntrl A G 2: 35,129,634 E491G probably benign Het
Ctdnep1 T C 11: 69,989,508 F206L probably damaging Het
Dido1 T C 2: 180,662,152 K1320E probably damaging Het
Dmbt1 G T 7: 131,066,733 C573F possibly damaging Het
Dmtn A G 14: 70,613,336 I205T probably benign Het
Eif4g3 C T 4: 138,058,003 H137Y probably damaging Het
Flg2 G T 3: 93,201,859 C398F possibly damaging Het
Gabbr1 A G 17: 37,069,365 D604G probably damaging Het
Glis2 T A 16: 4,610,333 L83* probably null Het
Glra3 A G 8: 55,991,256 probably null Het
Gm15448 A G 7: 3,821,718 I554T probably damaging Het
Gm8890 C T 5: 11,257,230 T25I probably damaging Het
Hipk3 T C 2: 104,433,741 D804G probably damaging Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Lrrc9 A T 12: 72,459,853 E301D probably damaging Het
Ms4a6c T C 19: 11,471,136 I11T possibly damaging Het
Myo1d A T 11: 80,779,791 M1K probably null Het
Nav3 A G 10: 109,852,565 L617P probably damaging Het
Olfr918 A G 9: 38,673,214 S90P probably benign Het
Pcsk7 A C 9: 45,910,376 N156T possibly damaging Het
Pde4d C T 13: 109,949,433 S515L probably damaging Het
Prom2 A G 2: 127,539,775 probably null Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Scn3a T C 2: 65,495,036 I1046V probably benign Het
Slc13a1 A T 6: 24,090,796 Y541* probably null Het
Spen C T 4: 141,479,112 E735K unknown Het
Tm6sf2 T C 8: 70,073,074 V27A possibly damaging Het
Trim21 A G 7: 102,559,439 S358P probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Ttn T A 2: 76,880,208 probably benign Het
Vmn2r99 A G 17: 19,382,558 Q525R probably benign Het
Ywhag A G 5: 135,911,074 I222T probably damaging Het
Other mutations in Vsig10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Vsig10 APN 5 117338414 missense probably benign 0.00
IGL00340:Vsig10 APN 5 117351587 missense probably benign 0.03
IGL01082:Vsig10 APN 5 117334905 missense probably benign 0.33
IGL01285:Vsig10 APN 5 117324889 missense probably benign 0.43
IGL01790:Vsig10 APN 5 117338314 missense probably damaging 1.00
IGL03004:Vsig10 APN 5 117325075 missense probably damaging 1.00
D3080:Vsig10 UTSW 5 117343819 missense probably damaging 1.00
R0101:Vsig10 UTSW 5 117335069 critical splice donor site probably null
R0403:Vsig10 UTSW 5 117338461 missense probably benign 0.05
R0674:Vsig10 UTSW 5 117343846 missense probably damaging 1.00
R1437:Vsig10 UTSW 5 117351570 missense probably damaging 0.96
R1689:Vsig10 UTSW 5 117352760 missense probably benign 0.00
R1710:Vsig10 UTSW 5 117351654 missense probably benign
R1765:Vsig10 UTSW 5 117318815 unclassified probably benign
R4422:Vsig10 UTSW 5 117324921 missense probably benign 0.00
R4541:Vsig10 UTSW 5 117352816 utr 3 prime probably benign
R4909:Vsig10 UTSW 5 117338243 missense probably benign 0.31
R4999:Vsig10 UTSW 5 117343975 missense probably damaging 1.00
R5855:Vsig10 UTSW 5 117338270 missense probably damaging 1.00
R5866:Vsig10 UTSW 5 117352749 critical splice acceptor site probably null
R6418:Vsig10 UTSW 5 117348296 missense probably benign 0.03
R6505:Vsig10 UTSW 5 117351759 missense possibly damaging 0.95
R6854:Vsig10 UTSW 5 117338407 missense probably benign 0.36
R7121:Vsig10 UTSW 5 117343902 missense probably damaging 1.00
R7596:Vsig10 UTSW 5 117334783 missense possibly damaging 0.46
R8066:Vsig10 UTSW 5 117351784 missense probably benign 0.00
R8335:Vsig10 UTSW 5 117348370 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCATGAGAACTTGCTTCGTGG -3'
(R):5'- TCTCAAACCACAGGCAAGTG -3'

Sequencing Primer
(F):5'- GGGGGCAACGTGACTCTC -3'
(R):5'- TTGACCATGGCCCATGAAG -3'
Posted On2018-02-27