Incidental Mutation 'R6214:Ywhag'
ID503613
Institutional Source Beutler Lab
Gene Symbol Ywhag
Ensembl Gene ENSMUSG00000051391
Gene Nametyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide
Synonyms14-3-3 gamma, D7Bwg1348e
MMRRC Submission 044347-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6214 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location135908409-135934616 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135911074 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 222 (I222T)
Ref Sequence ENSEMBL: ENSMUSP00000143631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055808] [ENSMUST00000198270]
Predicted Effect probably damaging
Transcript: ENSMUST00000055808
AA Change: I222T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051223
Gene: ENSMUSG00000051391
AA Change: I222T

DomainStartEndE-ValueType
14_3_3 4 247 3.44e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198270
AA Change: I222T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143631
Gene: ENSMUSG00000051391
AA Change: I222T

DomainStartEndE-ValueType
14_3_3 4 247 3.44e-137 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the 14-3-3 family of proteins which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals, and this protein is 100% identical to the rat ortholog. It is induced by growth factors in human vascular smooth muscle cells, and is also highly expressed in skeletal and heart muscles, suggesting an important role for this protein in muscle tissue. It has been shown to interact with RAF1 and protein kinase C, proteins involved in various signal transduction pathways. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants appear normal and exhibit unchanged survival rates after inoculation with pathological prion protein. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap3 A C 4: 136,241,425 D727A possibly damaging Het
Aste1 A G 9: 105,396,857 K38E probably damaging Het
Atp13a5 T C 16: 29,251,407 Y909C probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cd79b C A 11: 106,312,441 probably null Het
Chia1 T C 3: 106,122,445 F132L probably damaging Het
Cntrl A G 2: 35,129,634 E491G probably benign Het
Ctdnep1 T C 11: 69,989,508 F206L probably damaging Het
Dido1 T C 2: 180,662,152 K1320E probably damaging Het
Dmbt1 G T 7: 131,066,733 C573F possibly damaging Het
Dmtn A G 14: 70,613,336 I205T probably benign Het
Eif4g3 C T 4: 138,058,003 H137Y probably damaging Het
Flg2 G T 3: 93,201,859 C398F possibly damaging Het
Gabbr1 A G 17: 37,069,365 D604G probably damaging Het
Glis2 T A 16: 4,610,333 L83* probably null Het
Glra3 A G 8: 55,991,256 probably null Het
Gm15448 A G 7: 3,821,718 I554T probably damaging Het
Gm8890 C T 5: 11,257,230 T25I probably damaging Het
Hipk3 T C 2: 104,433,741 D804G probably damaging Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Lrrc9 A T 12: 72,459,853 E301D probably damaging Het
Ms4a6c T C 19: 11,471,136 I11T possibly damaging Het
Myo1d A T 11: 80,779,791 M1K probably null Het
Nav3 A G 10: 109,852,565 L617P probably damaging Het
Olfr918 A G 9: 38,673,214 S90P probably benign Het
Pcsk7 A C 9: 45,910,376 N156T possibly damaging Het
Pde4d C T 13: 109,949,433 S515L probably damaging Het
Prom2 A G 2: 127,539,775 probably null Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Scn3a T C 2: 65,495,036 I1046V probably benign Het
Slc13a1 A T 6: 24,090,796 Y541* probably null Het
Spen C T 4: 141,479,112 E735K unknown Het
Tm6sf2 T C 8: 70,073,074 V27A possibly damaging Het
Trim21 A G 7: 102,559,439 S358P probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Ttn T A 2: 76,880,208 probably benign Het
Vmn2r99 A G 17: 19,382,558 Q525R probably benign Het
Vsig10 G A 5: 117,343,924 C393Y probably damaging Het
Other mutations in Ywhag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02036:Ywhag APN 5 135911494 missense probably benign 0.08
IGL03200:Ywhag APN 5 135911060 nonsense probably null
IGL03206:Ywhag APN 5 135911060 nonsense probably null
R0047:Ywhag UTSW 5 135911299 missense probably damaging 0.97
R0047:Ywhag UTSW 5 135911299 missense probably damaging 0.97
R1834:Ywhag UTSW 5 135911530 missense probably damaging 0.99
R5425:Ywhag UTSW 5 135911265 missense probably benign 0.19
R5974:Ywhag UTSW 5 135911629 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTCCCTGGGAAGGTCAC -3'
(R):5'- TATTACCGTTACCTGGCAGAAGTG -3'

Sequencing Primer
(F):5'- TGGGAAGGTCACCCCTC -3'
(R):5'- TCGTCTGAGAAGGCCTACAG -3'
Posted On2018-02-27