Incidental Mutation 'R6214:Cd79b'
ID 503629
Institutional Source Beutler Lab
Gene Symbol Cd79b
Ensembl Gene ENSMUSG00000040592
Gene Name CD79B antigen
Synonyms Igbeta, B29, Ig-beta, Igb
MMRRC Submission 044347-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R6214 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 106202167-106205388 bp(-) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) C to A at 106203267 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044228] [ENSMUST00000044228] [ENSMUST00000167143] [ENSMUST00000167143]
AlphaFold P15530
PDB Structure Crystal structure of murine Ig-beta (CD79b) homodimer [X-RAY DIFFRACTION]
Crystal structure of murine Ig-beta (CD79b) in the monomeric form [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000044228
SMART Domains Protein: ENSMUSP00000048239
Gene: ENSMUSG00000040592

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
IG 110 202 3.56e-9 SMART
transmembrane domain 220 239 N/A INTRINSIC
ITAM 252 272 2.41e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000044228
SMART Domains Protein: ENSMUSP00000048239
Gene: ENSMUSG00000040592

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
IG 110 202 3.56e-9 SMART
transmembrane domain 220 239 N/A INTRINSIC
ITAM 252 272 2.41e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167143
SMART Domains Protein: ENSMUSP00000129029
Gene: ENSMUSG00000040592

DomainStartEndE-ValueType
low complexity region 14 21 N/A INTRINSIC
IG 50 142 3.56e-9 SMART
transmembrane domain 160 179 N/A INTRINSIC
ITAM 192 212 2.41e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167143
SMART Domains Protein: ENSMUSP00000129029
Gene: ENSMUSG00000040592

DomainStartEndE-ValueType
low complexity region 14 21 N/A INTRINSIC
IG 50 142 3.56e-9 SMART
transmembrane domain 160 179 N/A INTRINSIC
ITAM 192 212 2.41e-4 SMART
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-beta protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of B cells at the pro-B cell stage due to diminished signaling of the B cell receptor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap3 A C 4: 135,968,736 (GRCm39) D727A possibly damaging Het
Aste1 A G 9: 105,274,056 (GRCm39) K38E probably damaging Het
Atp13a5 T C 16: 29,070,159 (GRCm39) Y909C probably damaging Het
Ccdc13 A G 9: 121,627,975 (GRCm39) probably benign Het
Chia1 T C 3: 106,029,761 (GRCm39) F132L probably damaging Het
Cntrl A G 2: 35,019,646 (GRCm39) E491G probably benign Het
Ctdnep1 T C 11: 69,880,334 (GRCm39) F206L probably damaging Het
Dido1 T C 2: 180,303,945 (GRCm39) K1320E probably damaging Het
Dmbt1 G T 7: 130,668,463 (GRCm39) C573F possibly damaging Het
Dmtn A G 14: 70,850,776 (GRCm39) I205T probably benign Het
Eif4g3 C T 4: 137,785,314 (GRCm39) H137Y probably damaging Het
Flg2 G T 3: 93,109,166 (GRCm39) C398F possibly damaging Het
Gabbr1 A G 17: 37,380,257 (GRCm39) D604G probably damaging Het
Glis2 T A 16: 4,428,197 (GRCm39) L83* probably null Het
Glra3 A G 8: 56,444,291 (GRCm39) probably null Het
Hipk3 T C 2: 104,264,086 (GRCm39) D804G probably damaging Het
Kcnd1 G C X: 7,690,148 (GRCm39) A23P probably damaging Homo
Lrrc9 A T 12: 72,506,627 (GRCm39) E301D probably damaging Het
Ms4a6c T C 19: 11,448,500 (GRCm39) I11T possibly damaging Het
Myo1d A T 11: 80,670,617 (GRCm39) M1K probably null Het
Nav3 A G 10: 109,688,426 (GRCm39) L617P probably damaging Het
Or8b3b A G 9: 38,584,510 (GRCm39) S90P probably benign Het
Pcsk7 A C 9: 45,821,674 (GRCm39) N156T possibly damaging Het
Pde4d C T 13: 110,085,967 (GRCm39) S515L probably damaging Het
Pira13 A G 7: 3,824,717 (GRCm39) I554T probably damaging Het
Prom2 A G 2: 127,381,695 (GRCm39) probably null Het
Rsf1 G GACGGCGGCA 7: 97,229,116 (GRCm39) probably benign Het
Scn3a T C 2: 65,325,380 (GRCm39) I1046V probably benign Het
Slc13a1 A T 6: 24,090,795 (GRCm39) Y541* probably null Het
Speer1d C T 5: 11,307,197 (GRCm39) T25I probably damaging Het
Spen C T 4: 141,206,423 (GRCm39) E735K unknown Het
Tm6sf2 T C 8: 70,525,724 (GRCm39) V27A possibly damaging Het
Trim21 A G 7: 102,208,646 (GRCm39) S358P probably damaging Het
Ttc21a A G 9: 119,795,838 (GRCm39) Y1224C probably damaging Het
Ttn T A 2: 76,710,552 (GRCm39) probably benign Het
Vmn2r99 A G 17: 19,602,820 (GRCm39) Q525R probably benign Het
Vsig10 G A 5: 117,481,989 (GRCm39) C393Y probably damaging Het
Ywhag A G 5: 135,939,928 (GRCm39) I222T probably damaging Het
Other mutations in Cd79b
AlleleSourceChrCoordTypePredicted EffectPPH Score
hallasan UTSW 11 106,203,267 (GRCm39) critical splice acceptor site probably null
Jeju UTSW 11 106,203,539 (GRCm39) missense probably damaging 1.00
R0070:Cd79b UTSW 11 106,202,744 (GRCm39) splice site probably benign
R0070:Cd79b UTSW 11 106,202,744 (GRCm39) splice site probably benign
R0731:Cd79b UTSW 11 106,203,259 (GRCm39) missense probably damaging 1.00
R4400:Cd79b UTSW 11 106,202,836 (GRCm39) nonsense probably null
R4591:Cd79b UTSW 11 106,202,872 (GRCm39) missense probably damaging 1.00
R4948:Cd79b UTSW 11 106,203,687 (GRCm39) missense probably benign 0.01
R6215:Cd79b UTSW 11 106,203,267 (GRCm39) critical splice acceptor site probably null
R6605:Cd79b UTSW 11 106,203,539 (GRCm39) missense probably damaging 1.00
R7111:Cd79b UTSW 11 106,205,365 (GRCm39) missense possibly damaging 0.73
R7114:Cd79b UTSW 11 106,202,713 (GRCm39) missense probably damaging 1.00
R7401:Cd79b UTSW 11 106,203,678 (GRCm39) missense probably benign 0.02
R8052:Cd79b UTSW 11 106,204,526 (GRCm39) missense probably damaging 0.97
R8790:Cd79b UTSW 11 106,202,873 (GRCm39) missense possibly damaging 0.93
R8921:Cd79b UTSW 11 106,203,632 (GRCm39) missense probably benign 0.07
R9717:Cd79b UTSW 11 106,202,845 (GRCm39) missense probably damaging 1.00
R9753:Cd79b UTSW 11 106,203,457 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATATGGAGACCCTGCCCATG -3'
(R):5'- TGGCACGGAACTTCTAGTCTTAG -3'

Sequencing Primer
(F):5'- AGACCCTGCCCATGTCCTG -3'
(R):5'- GGTAGATTGTGTAGCCATCCACAC -3'
Posted On 2018-02-27