Incidental Mutation 'R6214:Glis2'
ID503633
Institutional Source Beutler Lab
Gene Symbol Glis2
Ensembl Gene ENSMUSG00000014303
Gene NameGLIS family zinc finger 2
SynonymsNkl
MMRRC Submission 044347-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.891) question?
Stock #R6214 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location4594713-4624924 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 4610333 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 83 (L83*)
Ref Sequence ENSEMBL: ENSMUSP00000115728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014447] [ENSMUST00000141682]
Predicted Effect probably null
Transcript: ENSMUST00000014447
AA Change: L83*
SMART Domains Protein: ENSMUSP00000014447
Gene: ENSMUSG00000014303
AA Change: L83*

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 74 100 N/A INTRINSIC
ZnF_C2H2 168 193 1.05e1 SMART
ZnF_C2H2 202 229 8.09e0 SMART
ZnF_C2H2 235 257 1.82e-3 SMART
ZnF_C2H2 263 287 3.16e-3 SMART
ZnF_C2H2 293 317 1.04e-3 SMART
low complexity region 328 342 N/A INTRINSIC
low complexity region 358 385 N/A INTRINSIC
low complexity region 387 402 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
low complexity region 420 445 N/A INTRINSIC
low complexity region 468 475 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135577
Predicted Effect probably null
Transcript: ENSMUST00000141682
AA Change: L83*
SMART Domains Protein: ENSMUSP00000115728
Gene: ENSMUSG00000014303
AA Change: L83*

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 74 100 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the GLI-similar zinc finger protein family and encodes a nuclear transcription factor with five C2H2-type zinc finger domains. The protein encoded by this gene is widely expressed at low levels in the neural tube and peripheral nervous system and likely promotes neuronal differentiation. It is abundantly expressed in the kidney and may have a role in the regulation of kidney morphogenesis. p120 regulates the expression level of this protein and induces the cleavage of this protein's C-terminal zinc finger domain. This protein also promotes the nuclear translocation of p120. Mutations in this gene cause nephronophthisis (NPHP), an autosomal recessive kidney disease characterized by tubular basement membrane disruption, interstitial lymphohistiocytic cell infiltration, and development of cysts at the corticomedullary border of the kidneys.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a fusion allele exhibit decreased kidney weight, kidney atrophy, kidney cysts, and interstitial fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap3 A C 4: 136,241,425 D727A possibly damaging Het
Aste1 A G 9: 105,396,857 K38E probably damaging Het
Atp13a5 T C 16: 29,251,407 Y909C probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cd79b C A 11: 106,312,441 probably null Het
Chia1 T C 3: 106,122,445 F132L probably damaging Het
Cntrl A G 2: 35,129,634 E491G probably benign Het
Ctdnep1 T C 11: 69,989,508 F206L probably damaging Het
Dido1 T C 2: 180,662,152 K1320E probably damaging Het
Dmbt1 G T 7: 131,066,733 C573F possibly damaging Het
Dmtn A G 14: 70,613,336 I205T probably benign Het
Eif4g3 C T 4: 138,058,003 H137Y probably damaging Het
Flg2 G T 3: 93,201,859 C398F possibly damaging Het
Gabbr1 A G 17: 37,069,365 D604G probably damaging Het
Glra3 A G 8: 55,991,256 probably null Het
Gm15448 A G 7: 3,821,718 I554T probably damaging Het
Gm8890 C T 5: 11,257,230 T25I probably damaging Het
Hipk3 T C 2: 104,433,741 D804G probably damaging Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Lrrc9 A T 12: 72,459,853 E301D probably damaging Het
Ms4a6c T C 19: 11,471,136 I11T possibly damaging Het
Myo1d A T 11: 80,779,791 M1K probably null Het
Nav3 A G 10: 109,852,565 L617P probably damaging Het
Olfr918 A G 9: 38,673,214 S90P probably benign Het
Pcsk7 A C 9: 45,910,376 N156T possibly damaging Het
Pde4d C T 13: 109,949,433 S515L probably damaging Het
Prom2 A G 2: 127,539,775 probably null Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Scn3a T C 2: 65,495,036 I1046V probably benign Het
Slc13a1 A T 6: 24,090,796 Y541* probably null Het
Spen C T 4: 141,479,112 E735K unknown Het
Tm6sf2 T C 8: 70,073,074 V27A possibly damaging Het
Trim21 A G 7: 102,559,439 S358P probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Ttn T A 2: 76,880,208 probably benign Het
Vmn2r99 A G 17: 19,382,558 Q525R probably benign Het
Vsig10 G A 5: 117,343,924 C393Y probably damaging Het
Ywhag A G 5: 135,911,074 I222T probably damaging Het
Other mutations in Glis2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Glis2 APN 16 4611650 missense probably damaging 1.00
IGL01680:Glis2 APN 16 4611331 missense possibly damaging 0.82
IGL02055:Glis2 APN 16 4614108 unclassified probably benign
IGL02802:Glis2 UTSW 16 4611871 critical splice donor site probably null
R0081:Glis2 UTSW 16 4613653 missense probably benign 0.22
R0517:Glis2 UTSW 16 4611552 missense probably damaging 0.98
R2010:Glis2 UTSW 16 4608711 missense probably damaging 0.99
R2145:Glis2 UTSW 16 4613642 missense possibly damaging 0.79
R3780:Glis2 UTSW 16 4613896 unclassified probably benign
R4180:Glis2 UTSW 16 4611376 missense probably benign 0.04
R5213:Glis2 UTSW 16 4614082 unclassified probably benign
R6012:Glis2 UTSW 16 4611308 missense possibly damaging 0.76
R6052:Glis2 UTSW 16 4613739 unclassified probably benign
R6215:Glis2 UTSW 16 4610333 nonsense probably null
R6316:Glis2 UTSW 16 4613836 unclassified probably benign
R7172:Glis2 UTSW 16 4613475 missense probably benign 0.32
R7286:Glis2 UTSW 16 4611318 missense possibly damaging 0.93
R7346:Glis2 UTSW 16 4613568 missense possibly damaging 0.83
R7816:Glis2 UTSW 16 4613464 missense probably damaging 1.00
X0020:Glis2 UTSW 16 4608653 missense probably damaging 1.00
X0027:Glis2 UTSW 16 4611457 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTATGCTAGCTGTTCCTTGGATGTC -3'
(R):5'- TGGCCTCGAACTCAGAAATCC -3'

Sequencing Primer
(F):5'- CCTTGGATGTCTGGGGTCCC -3'
(R):5'- AGAAATCCGCCTGCCTCTG -3'
Posted On2018-02-27