Incidental Mutation 'R6214:Vmn2r99'
ID503635
Institutional Source Beutler Lab
Gene Symbol Vmn2r99
Ensembl Gene ENSMUSG00000090304
Gene Namevomeronasal 2, receptor 99
SynonymsEG665376
MMRRC Submission 044347-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R6214 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location19361949-19401098 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19382558 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 525 (Q525R)
Ref Sequence ENSEMBL: ENSMUSP00000156067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176107] [ENSMUST00000231989]
Predicted Effect probably benign
Transcript: ENSMUST00000176107
AA Change: Q525R

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000135236
Gene: ENSMUSG00000090304
AA Change: Q525R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 81 448 5.7e-33 PFAM
Pfam:NCD3G 508 561 1.8e-21 PFAM
Pfam:7tm_3 593 829 4.6e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231989
AA Change: Q525R

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap3 A C 4: 136,241,425 D727A possibly damaging Het
Aste1 A G 9: 105,396,857 K38E probably damaging Het
Atp13a5 T C 16: 29,251,407 Y909C probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cd79b C A 11: 106,312,441 probably null Het
Chia1 T C 3: 106,122,445 F132L probably damaging Het
Cntrl A G 2: 35,129,634 E491G probably benign Het
Ctdnep1 T C 11: 69,989,508 F206L probably damaging Het
Dido1 T C 2: 180,662,152 K1320E probably damaging Het
Dmbt1 G T 7: 131,066,733 C573F possibly damaging Het
Dmtn A G 14: 70,613,336 I205T probably benign Het
Eif4g3 C T 4: 138,058,003 H137Y probably damaging Het
Flg2 G T 3: 93,201,859 C398F possibly damaging Het
Gabbr1 A G 17: 37,069,365 D604G probably damaging Het
Glis2 T A 16: 4,610,333 L83* probably null Het
Glra3 A G 8: 55,991,256 probably null Het
Gm15448 A G 7: 3,821,718 I554T probably damaging Het
Gm8890 C T 5: 11,257,230 T25I probably damaging Het
Hipk3 T C 2: 104,433,741 D804G probably damaging Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Lrrc9 A T 12: 72,459,853 E301D probably damaging Het
Ms4a6c T C 19: 11,471,136 I11T possibly damaging Het
Myo1d A T 11: 80,779,791 M1K probably null Het
Nav3 A G 10: 109,852,565 L617P probably damaging Het
Olfr918 A G 9: 38,673,214 S90P probably benign Het
Pcsk7 A C 9: 45,910,376 N156T possibly damaging Het
Pde4d C T 13: 109,949,433 S515L probably damaging Het
Prom2 A G 2: 127,539,775 probably null Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Scn3a T C 2: 65,495,036 I1046V probably benign Het
Slc13a1 A T 6: 24,090,796 Y541* probably null Het
Spen C T 4: 141,479,112 E735K unknown Het
Tm6sf2 T C 8: 70,073,074 V27A possibly damaging Het
Trim21 A G 7: 102,559,439 S358P probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Ttn T A 2: 76,880,208 probably benign Het
Vsig10 G A 5: 117,343,924 C393Y probably damaging Het
Ywhag A G 5: 135,911,074 I222T probably damaging Het
Other mutations in Vmn2r99
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Vmn2r99 APN 17 19378854 missense probably benign 0.01
IGL01113:Vmn2r99 APN 17 19394256 missense probably benign 0.20
IGL01138:Vmn2r99 APN 17 19382623 missense probably damaging 0.97
IGL01646:Vmn2r99 APN 17 19393658 splice site probably benign
IGL01769:Vmn2r99 APN 17 19380115 missense probably damaging 1.00
IGL02112:Vmn2r99 APN 17 19380232 missense probably null 0.99
IGL02891:Vmn2r99 APN 17 19378690 nonsense probably null
IGL03132:Vmn2r99 APN 17 19378223 nonsense probably null
FR4548:Vmn2r99 UTSW 17 19394285 missense probably damaging 0.97
FR4976:Vmn2r99 UTSW 17 19394285 missense probably damaging 0.97
PIT4382001:Vmn2r99 UTSW 17 19394343 missense probably damaging 1.00
R0196:Vmn2r99 UTSW 17 19394573 missense probably benign 0.00
R0720:Vmn2r99 UTSW 17 19379043 missense probably benign 0.00
R1501:Vmn2r99 UTSW 17 19362259 missense possibly damaging 0.93
R1519:Vmn2r99 UTSW 17 19380060 missense probably benign 0.00
R1670:Vmn2r99 UTSW 17 19362252 missense probably benign 0.37
R1682:Vmn2r99 UTSW 17 19377945 missense probably damaging 0.97
R1873:Vmn2r99 UTSW 17 19362153 missense probably benign 0.25
R1967:Vmn2r99 UTSW 17 19378815 missense probably benign 0.01
R2101:Vmn2r99 UTSW 17 19377991 missense probably damaging 1.00
R2474:Vmn2r99 UTSW 17 19378629 missense probably benign 0.04
R2519:Vmn2r99 UTSW 17 19378708 missense probably damaging 0.99
R3911:Vmn2r99 UTSW 17 19394373 missense possibly damaging 0.92
R3947:Vmn2r99 UTSW 17 19378990 missense probably benign 0.40
R3949:Vmn2r99 UTSW 17 19378990 missense probably benign 0.40
R4016:Vmn2r99 UTSW 17 19378570 missense possibly damaging 0.86
R4413:Vmn2r99 UTSW 17 19379260 missense probably damaging 1.00
R4594:Vmn2r99 UTSW 17 19393662 missense probably damaging 1.00
R4999:Vmn2r99 UTSW 17 19362135 start codon destroyed probably null 0.96
R5206:Vmn2r99 UTSW 17 19378606 missense probably benign 0.40
R5362:Vmn2r99 UTSW 17 19379339 missense probably benign 0.00
R5377:Vmn2r99 UTSW 17 19379269 missense probably damaging 1.00
R5455:Vmn2r99 UTSW 17 19394146 nonsense probably null
R6021:Vmn2r99 UTSW 17 19377948 missense probably damaging 1.00
R6059:Vmn2r99 UTSW 17 19378980 missense probably benign 0.00
R6215:Vmn2r99 UTSW 17 19382558 missense probably benign 0.19
R6313:Vmn2r99 UTSW 17 19382605 missense probably damaging 1.00
R6646:Vmn2r99 UTSW 17 19380031 missense probably damaging 1.00
R6810:Vmn2r99 UTSW 17 19380034 missense probably benign 0.20
R6885:Vmn2r99 UTSW 17 19380195 missense possibly damaging 0.52
R6991:Vmn2r99 UTSW 17 19378110 missense probably benign 0.03
R7060:Vmn2r99 UTSW 17 19394564 nonsense probably null
R7090:Vmn2r99 UTSW 17 19393710 missense possibly damaging 0.83
R7094:Vmn2r99 UTSW 17 19379311 missense probably benign 0.00
R7449:Vmn2r99 UTSW 17 19379145 missense probably benign 0.01
Z1088:Vmn2r99 UTSW 17 19379301 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TGGGAATTTCTGTTAGCTACTCC -3'
(R):5'- GACCTATTTCAAGGGTATTGTGATG -3'

Sequencing Primer
(F):5'- GGAATTTCTGTTAGCTACTCCACTTC -3'
(R):5'- AGGGTATTGTGATGAATATGACATTG -3'
Posted On2018-02-27