Mutagenetix > Incidental Mutations

Incidental Mutation 'R6214:Vmn2r99'

503635

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r99

Ensembl Gene

ENSMUSG00000090304

Gene Name

vomeronasal 2, receptor 99

Synonyms

EG665376

MMRRC Submission

044347-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.130) question?

Stock #

R6214 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

19361949-19401098 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 19382558 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 525 (Q525R)

Ref Sequence

ENSEMBL: ENSMUSP00000156067 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000176107] [ENSMUST00000231989]

Predicted Effect

probably benign
Transcript: ENSMUST00000176107
AA Change: Q525R

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000135236
Gene: ENSMUSG00000090304
AA Change: Q525R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	81	448	5.7e-33	PFAM
Pfam:NCD3G	508	561	1.8e-21	PFAM
Pfam:7tm_3	593	829	4.6e-52	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000231989
AA Change: Q525R

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

97% (37/38)

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asap3	A	C	4: 136,241,425	D727A	possibly damaging	Het
Aste1	A	G	9: 105,396,857	K38E	probably damaging	Het
Atp13a5	T	C	16: 29,251,407	Y909C	probably damaging	Het
Ccdc13	A	G	9: 121,798,909		probably benign	Het
Cd79b	C	A	11: 106,312,441		probably null	Het
Chia1	T	C	3: 106,122,445	F132L	probably damaging	Het
Cntrl	A	G	2: 35,129,634	E491G	probably benign	Het
Ctdnep1	T	C	11: 69,989,508	F206L	probably damaging	Het
Dido1	T	C	2: 180,662,152	K1320E	probably damaging	Het
Dmbt1	G	T	7: 131,066,733	C573F	possibly damaging	Het
Dmtn	A	G	14: 70,613,336	I205T	probably benign	Het
Eif4g3	C	T	4: 138,058,003	H137Y	probably damaging	Het
Flg2	G	T	3: 93,201,859	C398F	possibly damaging	Het
Gabbr1	A	G	17: 37,069,365	D604G	probably damaging	Het
Glis2	T	A	16: 4,610,333	L83*	probably null	Het
Glra3	A	G	8: 55,991,256		probably null	Het
Gm15448	A	G	7: 3,821,718	I554T	probably damaging	Het
Gm8890	C	T	5: 11,257,230	T25I	probably damaging	Het
Hipk3	T	C	2: 104,433,741	D804G	probably damaging	Het
Kcnd1	G	C	X: 7,823,909	A23P	probably damaging	Homo
Lrrc9	A	T	12: 72,459,853	E301D	probably damaging	Het
Ms4a6c	T	C	19: 11,471,136	I11T	possibly damaging	Het
Myo1d	A	T	11: 80,779,791	M1K	probably null	Het
Nav3	A	G	10: 109,852,565	L617P	probably damaging	Het
Olfr918	A	G	9: 38,673,214	S90P	probably benign	Het
Pcsk7	A	C	9: 45,910,376	N156T	possibly damaging	Het
Pde4d	C	T	13: 109,949,433	S515L	probably damaging	Het
Prom2	A	G	2: 127,539,775		probably null	Het
Rsf1	G	GACGGCGGCA	7: 97,579,909		probably benign	Het
Scn3a	T	C	2: 65,495,036	I1046V	probably benign	Het
Slc13a1	A	T	6: 24,090,796	Y541*	probably null	Het
Spen	C	T	4: 141,479,112	E735K	unknown	Het
Tm6sf2	T	C	8: 70,073,074	V27A	possibly damaging	Het
Trim21	A	G	7: 102,559,439	S358P	probably damaging	Het
Ttc21a	A	G	9: 119,966,772	Y1224C	probably damaging	Het
Ttn	T	A	2: 76,880,208		probably benign	Het
Vsig10	G	A	5: 117,343,924	C393Y	probably damaging	Het
Ywhag	A	G	5: 135,911,074	I222T	probably damaging	Het

Other mutations in Vmn2r99

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Vmn2r99	APN	17	19378854	missense	probably benign	0.01
IGL01113:Vmn2r99	APN	17	19394256	missense	probably benign	0.20
IGL01138:Vmn2r99	APN	17	19382623	missense	probably damaging	0.97
IGL01646:Vmn2r99	APN	17	19393658	splice site	probably benign
IGL01769:Vmn2r99	APN	17	19380115	missense	probably damaging	1.00
IGL02112:Vmn2r99	APN	17	19380232	missense	probably null	0.99
IGL02891:Vmn2r99	APN	17	19378690	nonsense	probably null
IGL03132:Vmn2r99	APN	17	19378223	nonsense	probably null
FR4548:Vmn2r99	UTSW	17	19394285	missense	probably damaging	0.97
FR4976:Vmn2r99	UTSW	17	19394285	missense	probably damaging	0.97
PIT4382001:Vmn2r99	UTSW	17	19394343	missense	probably damaging	1.00
R0196:Vmn2r99	UTSW	17	19394573	missense	probably benign	0.00
R0720:Vmn2r99	UTSW	17	19379043	missense	probably benign	0.00
R1501:Vmn2r99	UTSW	17	19362259	missense	possibly damaging	0.93
R1519:Vmn2r99	UTSW	17	19380060	missense	probably benign	0.00
R1670:Vmn2r99	UTSW	17	19362252	missense	probably benign	0.37
R1682:Vmn2r99	UTSW	17	19377945	missense	probably damaging	0.97
R1873:Vmn2r99	UTSW	17	19362153	missense	probably benign	0.25
R1967:Vmn2r99	UTSW	17	19378815	missense	probably benign	0.01
R2101:Vmn2r99	UTSW	17	19377991	missense	probably damaging	1.00
R2474:Vmn2r99	UTSW	17	19378629	missense	probably benign	0.04
R2519:Vmn2r99	UTSW	17	19378708	missense	probably damaging	0.99
R3911:Vmn2r99	UTSW	17	19394373	missense	possibly damaging	0.92
R3947:Vmn2r99	UTSW	17	19378990	missense	probably benign	0.40
R3949:Vmn2r99	UTSW	17	19378990	missense	probably benign	0.40
R4016:Vmn2r99	UTSW	17	19378570	missense	possibly damaging	0.86
R4413:Vmn2r99	UTSW	17	19379260	missense	probably damaging	1.00
R4594:Vmn2r99	UTSW	17	19393662	missense	probably damaging	1.00
R4999:Vmn2r99	UTSW	17	19362135	start codon destroyed	probably null	0.96
R5206:Vmn2r99	UTSW	17	19378606	missense	probably benign	0.40
R5362:Vmn2r99	UTSW	17	19379339	missense	probably benign	0.00
R5377:Vmn2r99	UTSW	17	19379269	missense	probably damaging	1.00
R5455:Vmn2r99	UTSW	17	19394146	nonsense	probably null
R6021:Vmn2r99	UTSW	17	19377948	missense	probably damaging	1.00
R6059:Vmn2r99	UTSW	17	19378980	missense	probably benign	0.00
R6215:Vmn2r99	UTSW	17	19382558	missense	probably benign	0.19
R6313:Vmn2r99	UTSW	17	19382605	missense	probably damaging	1.00
R6646:Vmn2r99	UTSW	17	19380031	missense	probably damaging	1.00
R6810:Vmn2r99	UTSW	17	19380034	missense	probably benign	0.20
R6885:Vmn2r99	UTSW	17	19380195	missense	possibly damaging	0.52
R6991:Vmn2r99	UTSW	17	19378110	missense	probably benign	0.03
R7060:Vmn2r99	UTSW	17	19394564	nonsense	probably null
R7090:Vmn2r99	UTSW	17	19393710	missense	possibly damaging	0.83
R7094:Vmn2r99	UTSW	17	19379311	missense	probably benign	0.00
R7449:Vmn2r99	UTSW	17	19379145	missense	probably benign	0.01
R7789:Vmn2r99	UTSW	17	19393817	missense	possibly damaging	0.91
R8039:Vmn2r99	UTSW	17	19380040	missense	probably benign	0.00
R8493:Vmn2r99	UTSW	17	19393758	missense	probably benign	0.15
R8511:Vmn2r99	UTSW	17	19394181	missense	probably damaging	1.00
R8715:Vmn2r99	UTSW	17	19393660	critical splice acceptor site	probably benign
Z1088:Vmn2r99	UTSW	17	19379301	missense	probably benign	0.18

Predicted Primers

PCR Primer
(F):5'- TGGGAATTTCTGTTAGCTACTCC -3'
(R):5'- GACCTATTTCAAGGGTATTGTGATG -3'

Sequencing Primer
(F):5'- GGAATTTCTGTTAGCTACTCCACTTC -3'
(R):5'- AGGGTATTGTGATGAATATGACATTG -3'

Posted On

2018-02-27